ID: 1085451462

View in Genome Browser
Species Human (GRCh38)
Location 11:76636544-76636566
Sequence TGGCAGCCACCCTCAGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451462_1085451470 30 Left 1085451462 11:76636544-76636566 CCCGGGGCTGAGGGTGGCTGCCA No data
Right 1085451470 11:76636597-76636619 AATGTCCAGTGCGAGACAGCAGG No data
1085451462_1085451468 6 Left 1085451462 11:76636544-76636566 CCCGGGGCTGAGGGTGGCTGCCA No data
Right 1085451468 11:76636573-76636595 ATGGGGAATCCATGCTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451462 Original CRISPR TGGCAGCCACCCTCAGCCCC GGG (reversed) Intergenic