ID: 1085451463

View in Genome Browser
Species Human (GRCh38)
Location 11:76636545-76636567
Sequence CTGGCAGCCACCCTCAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451463_1085451470 29 Left 1085451463 11:76636545-76636567 CCGGGGCTGAGGGTGGCTGCCAG No data
Right 1085451470 11:76636597-76636619 AATGTCCAGTGCGAGACAGCAGG No data
1085451463_1085451468 5 Left 1085451463 11:76636545-76636567 CCGGGGCTGAGGGTGGCTGCCAG No data
Right 1085451468 11:76636573-76636595 ATGGGGAATCCATGCTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451463 Original CRISPR CTGGCAGCCACCCTCAGCCC CGG (reversed) Intergenic