ID: 1085451464

View in Genome Browser
Species Human (GRCh38)
Location 11:76636554-76636576
Sequence AGGGTGGCTGCCAGTGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451460_1085451464 -9 Left 1085451460 11:76636540-76636562 CCTCCCCGGGGCTGAGGGTGGCT No data
Right 1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG No data
1085451448_1085451464 22 Left 1085451448 11:76636509-76636531 CCCCTTCCAGCCTCATGAGGATG No data
Right 1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG No data
1085451449_1085451464 21 Left 1085451449 11:76636510-76636532 CCCTTCCAGCCTCATGAGGATGG No data
Right 1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG No data
1085451452_1085451464 16 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG No data
1085451451_1085451464 20 Left 1085451451 11:76636511-76636533 CCTTCCAGCCTCATGAGGATGGC No data
Right 1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG No data
1085451453_1085451464 12 Left 1085451453 11:76636519-76636541 CCTCATGAGGATGGCTGTCATCC No data
Right 1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451464 Original CRISPR AGGGTGGCTGCCAGTGTCAA TGG Intergenic
No off target data available for this crispr