ID: 1085451466

View in Genome Browser
Species Human (GRCh38)
Location 11:76636556-76636578
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451460_1085451466 -7 Left 1085451460 11:76636540-76636562 CCTCCCCGGGGCTGAGGGTGGCT No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451452_1085451466 18 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451451_1085451466 22 Left 1085451451 11:76636511-76636533 CCTTCCAGCCTCATGAGGATGGC No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451449_1085451466 23 Left 1085451449 11:76636510-76636532 CCCTTCCAGCCTCATGAGGATGG No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451448_1085451466 24 Left 1085451448 11:76636509-76636531 CCCCTTCCAGCCTCATGAGGATG No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451453_1085451466 14 Left 1085451453 11:76636519-76636541 CCTCATGAGGATGGCTGTCATCC No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451461_1085451466 -10 Left 1085451461 11:76636543-76636565 CCCCGGGGCTGAGGGTGGCTGCC No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451466 Original CRISPR GGTGGCTGCCAGTGTCAATG GGG Intergenic