ID: 1085451468

View in Genome Browser
Species Human (GRCh38)
Location 11:76636573-76636595
Sequence ATGGGGAATCCATGCTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451462_1085451468 6 Left 1085451462 11:76636544-76636566 CCCGGGGCTGAGGGTGGCTGCCA No data
Right 1085451468 11:76636573-76636595 ATGGGGAATCCATGCTTGCATGG No data
1085451460_1085451468 10 Left 1085451460 11:76636540-76636562 CCTCCCCGGGGCTGAGGGTGGCT No data
Right 1085451468 11:76636573-76636595 ATGGGGAATCCATGCTTGCATGG No data
1085451461_1085451468 7 Left 1085451461 11:76636543-76636565 CCCCGGGGCTGAGGGTGGCTGCC No data
Right 1085451468 11:76636573-76636595 ATGGGGAATCCATGCTTGCATGG No data
1085451463_1085451468 5 Left 1085451463 11:76636545-76636567 CCGGGGCTGAGGGTGGCTGCCAG No data
Right 1085451468 11:76636573-76636595 ATGGGGAATCCATGCTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451468 Original CRISPR ATGGGGAATCCATGCTTGCA TGG Intergenic