ID: 1085452012

View in Genome Browser
Species Human (GRCh38)
Location 11:76639829-76639851
Sequence AGATGCAGAAAGTCACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085452008_1085452012 14 Left 1085452008 11:76639792-76639814 CCCAAGCAAGGTCAGATGGTGCC No data
Right 1085452012 11:76639829-76639851 AGATGCAGAAAGTCACAGCTTGG No data
1085452006_1085452012 18 Left 1085452006 11:76639788-76639810 CCTGCCCAAGCAAGGTCAGATGG No data
Right 1085452012 11:76639829-76639851 AGATGCAGAAAGTCACAGCTTGG No data
1085452009_1085452012 13 Left 1085452009 11:76639793-76639815 CCAAGCAAGGTCAGATGGTGCCA No data
Right 1085452012 11:76639829-76639851 AGATGCAGAAAGTCACAGCTTGG No data
1085452010_1085452012 -7 Left 1085452010 11:76639813-76639835 CCAAAGAGCCTGCAGCAGATGCA No data
Right 1085452012 11:76639829-76639851 AGATGCAGAAAGTCACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085452012 Original CRISPR AGATGCAGAAAGTCACAGCT TGG Intergenic
No off target data available for this crispr