ID: 1085452974

View in Genome Browser
Species Human (GRCh38)
Location 11:76648029-76648051
Sequence CTGGCTGAGGGTCCTTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085452963_1085452974 9 Left 1085452963 11:76647997-76648019 CCCCAAGACTACCTGTGCCTGTC No data
Right 1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG No data
1085452968_1085452974 -8 Left 1085452968 11:76648014-76648036 CCTGTCCCCTTCACTCTGGCTGA No data
Right 1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG No data
1085452964_1085452974 8 Left 1085452964 11:76647998-76648020 CCCAAGACTACCTGTGCCTGTCC No data
Right 1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG No data
1085452966_1085452974 -2 Left 1085452966 11:76648008-76648030 CCTGTGCCTGTCCCCTTCACTCT No data
Right 1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG No data
1085452962_1085452974 30 Left 1085452962 11:76647976-76647998 CCTGGGCTTGGGTGACATATTCC No data
Right 1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG No data
1085452965_1085452974 7 Left 1085452965 11:76647999-76648021 CCAAGACTACCTGTGCCTGTCCC No data
Right 1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085452974 Original CRISPR CTGGCTGAGGGTCCTTCTGT AGG Intergenic
No off target data available for this crispr