ID: 1085454231

View in Genome Browser
Species Human (GRCh38)
Location 11:76656708-76656730
Sequence CACCACTTAAAGCTGGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085454224_1085454231 13 Left 1085454224 11:76656672-76656694 CCAAGGGAAAAGGGCTTAGGATG 0: 1
1: 0
2: 0
3: 11
4: 203
Right 1085454231 11:76656708-76656730 CACCACTTAAAGCTGGCTCAAGG 0: 1
1: 1
2: 0
3: 10
4: 93
1085454223_1085454231 14 Left 1085454223 11:76656671-76656693 CCCAAGGGAAAAGGGCTTAGGAT 0: 1
1: 0
2: 0
3: 10
4: 176
Right 1085454231 11:76656708-76656730 CACCACTTAAAGCTGGCTCAAGG 0: 1
1: 1
2: 0
3: 10
4: 93
1085454219_1085454231 24 Left 1085454219 11:76656661-76656683 CCATAGTGTTCCCAAGGGAAAAG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1085454231 11:76656708-76656730 CACCACTTAAAGCTGGCTCAAGG 0: 1
1: 1
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085454231 Original CRISPR CACCACTTAAAGCTGGCTCA AGG Intergenic
902784486 1:18724210-18724232 CACCAGTCGAGGCTGGCTCAAGG + Intronic
903794359 1:25917638-25917660 CACCAAATGAAGCTGGCTGAAGG - Intergenic
905414801 1:37796467-37796489 AACCACTTGGAGCTGGCACAAGG + Intronic
909920475 1:81375210-81375232 GACCACTTAAGTCTGGCTCAAGG + Intronic
910669583 1:89759659-89759681 CAACACTTTAAACTGGCTCCAGG - Intronic
916619487 1:166480852-166480874 CACCTATAAAAGCTGGCTCTGGG - Intergenic
922075917 1:222244423-222244445 CACCACTTAAAACTGACAGATGG + Intergenic
1063121561 10:3108328-3108350 AACAAATTAAAGCTGGTTCAAGG + Intronic
1066590330 10:36987481-36987503 AGCCAGTTAAGGCTGGCTCAAGG - Intergenic
1068943478 10:62704766-62704788 CACCACCTAAATTTGTCTCAGGG + Intergenic
1069571436 10:69496687-69496709 CCCCACTGAGAGCTGGCACAAGG - Intronic
1070696118 10:78564451-78564473 GACAACTCAGAGCTGGCTCAAGG + Intergenic
1074469664 10:113715456-113715478 CACCACTTAAAGCCCTCCCAGGG - Intronic
1077416853 11:2427970-2427992 CATCACTCACAGCTGGCCCACGG - Intergenic
1085454231 11:76656708-76656730 CACCACTTAAAGCTGGCTCAAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089782440 11:120883089-120883111 CACCACTCTCAGCTGGCTCAGGG - Intronic
1091672174 12:2460014-2460036 CAACATTTACACCTGGCTCATGG + Intronic
1093381852 12:18502527-18502549 CAGTACTTAAAGCTCTCTCAGGG - Intronic
1096117722 12:49065182-49065204 CTCCTCTTATAGCTGACTCAAGG - Exonic
1096428574 12:51524475-51524497 CACCACTTCAAGGCAGCTCATGG - Intergenic
1100144307 12:91658666-91658688 CACCACCTTAAGATGGATCATGG + Intergenic
1109639067 13:65163185-65163207 AACAACCTAATGCTGGCTCAAGG + Intergenic
1114413132 14:22519017-22519039 CACCTCTTAAAGCTCCTTCAAGG - Intergenic
1115125045 14:29981988-29982010 CACCACTCAAAACTGCCTTATGG + Intronic
1115358361 14:32473836-32473858 CACCTCATACAGCTGGGTCATGG + Intronic
1116969516 14:51050040-51050062 CCCCACTAAAAACTGTCTCACGG - Intronic
1119923815 14:78472543-78472565 CTCCACTTAATGCTTGCTCAGGG + Intronic
1121042232 14:90758653-90758675 GACCTCTAAAAGCTGACTCAGGG - Intronic
1121645305 14:95514354-95514376 CAGCACTGAAAGCTGGCCCTTGG - Intergenic
1123122519 14:105924219-105924241 TAAAACTTAAAGCTGACTCAAGG - Intronic
1126415380 15:48412685-48412707 CACCACTGACAGGTGGCTCTGGG + Exonic
1128180759 15:65601640-65601662 CACCACTTAATACTGCCTTAAGG - Intronic
1134076765 16:11297449-11297471 CACCACTCAAATCAGGATCAAGG - Intronic
1134584969 16:15402469-15402491 CATCAAGTAATGCTGGCTCAGGG - Intronic
1135889371 16:26343352-26343374 AACCACTTACAGCTAGCTAATGG + Intergenic
1140711262 16:77679714-77679736 CAAGACTTTAAGATGGCTCAGGG - Intergenic
1141864066 16:86737738-86737760 CACAAATCAAAGATGGCTCAAGG - Intergenic
1142588973 17:992713-992735 AATCACTTAAAGCTGGGTAATGG + Intergenic
1144341222 17:14311857-14311879 CACCACTTAAAACAGGCTCGAGG + Intronic
1144759380 17:17698689-17698711 GCCCACTCACAGCTGGCTCAGGG - Intronic
1149400340 17:56289568-56289590 CAACACTTAAAGCAGCCACAGGG - Intronic
1150642992 17:66962264-66962286 CACCACCTCATGCTGGCTCCGGG - Intergenic
1159094649 18:63888666-63888688 CACCACTGAAACTTGGCACAGGG - Intronic
1161293236 19:3506726-3506748 CACGACTTACAGGTGGCTCGGGG - Intronic
1161748172 19:6074528-6074550 CAGCACTTGAAGCCGGCACATGG - Intronic
1164630264 19:29757513-29757535 GACCACTTAGAGATGGCCCAGGG + Intergenic
1167232365 19:48292967-48292989 CACCACACAAAGCTGCCTCCAGG + Intergenic
925045762 2:771905-771927 CACCTCTCTGAGCTGGCTCATGG - Intergenic
928637650 2:33264359-33264381 CACCAGTTAATACTGGATCATGG + Intronic
929044808 2:37778901-37778923 CACCATTTCATCCTGGCTCAGGG + Intergenic
933811127 2:86033382-86033404 GACCACTTACAGCGGGCTCTTGG + Intronic
937316248 2:120933728-120933750 CACAAGTTAACGCTGGCCCAGGG - Intronic
948728718 2:239950269-239950291 CACCACTCACAGCTTCCTCAGGG + Intronic
1171962229 20:31503201-31503223 CACCACTTGGACCTGGCTCATGG - Intergenic
1172911756 20:38414767-38414789 GATCAATTAAAGCTGGCTCCAGG - Intergenic
1173874620 20:46362581-46362603 CAGCATTAAATGCTGGCTCATGG + Intronic
1178417378 21:32414763-32414785 CACCACCTACTGCTGGCTCAGGG - Intronic
1179924403 21:44526216-44526238 CACCACGCAAAGCTGTGTCAGGG + Intronic
951458699 3:22924380-22924402 CACCACTTAAAGGTAGATTATGG + Intergenic
952056437 3:29452549-29452571 CAACACTTGAAGTTGGCTTACGG - Intronic
956749200 3:72332848-72332870 CTCCACTTAAGGCTGAGTCATGG - Intergenic
958256601 3:91332364-91332386 CACCCCTGAAAGCAGCCTCAGGG + Intergenic
958938172 3:100280724-100280746 TACCAGTTAAAGCTGGGTTATGG - Intronic
960384821 3:117010170-117010192 CACCACTGAAAGGTGCCACAGGG - Intronic
962957787 3:140282169-140282191 AACCATTCAGAGCTGGCTCATGG - Intronic
964277580 3:155024252-155024274 CTCCTCTGAAAGCTGGCCCAAGG + Intronic
970016134 4:11514795-11514817 CACCACTGAAATTCGGCTCAAGG - Intergenic
971166508 4:24189445-24189467 CAGCACTTACAGCTTTCTCAGGG - Intergenic
976920835 4:90441050-90441072 CACCACTTAAATCTAACTAATGG - Intronic
983743308 4:171162701-171162723 CACCACTTTGAGCTGGGTGAAGG + Intergenic
992917650 5:81475181-81475203 CAGTACTTAAAGCTGGATTAAGG + Intronic
992953243 5:81881494-81881516 CACCACTTGAAGCTGCGTGAAGG - Intergenic
993023464 5:82619604-82619626 CACCTCTTAAAGCTATCACATGG + Intergenic
995807306 5:116067782-116067804 CACCTCTTAAATCAGGCTCTAGG - Intergenic
999001905 5:147932838-147932860 TACCACATAAAGCTGCTTCAAGG + Intergenic
1000325116 5:160166114-160166136 CATCATTTAAAGCTGGATCTAGG - Intergenic
1003689852 6:8342997-8343019 CCCCATTTAAAGCTTTCTCATGG + Intergenic
1004070381 6:12292044-12292066 CCCCTCTTGAAGCAGGCTCAGGG - Intronic
1008998740 6:57688796-57688818 CACCCCTGAAAGCAGCCTCAGGG - Intergenic
1009187224 6:60588175-60588197 CACCCCTGAAAGCAGCCTCAGGG - Intergenic
1014243758 6:119045428-119045450 CATCACCTAGGGCTGGCTCAAGG + Intronic
1016310346 6:142727203-142727225 CAACTCTTAAAGGTGTCTCATGG + Intergenic
1020826758 7:13038462-13038484 AACCACTTAAAGCATACTCATGG + Intergenic
1021185164 7:17555680-17555702 AACCACATAAAGTTGGGTCAGGG + Intergenic
1022230866 7:28410610-28410632 CCCCACTTGATGCTTGCTCAAGG + Intronic
1023868534 7:44250498-44250520 CACTACTGAAAGATGGCTGAAGG - Intronic
1032493431 7:132342578-132342600 GACCACTGCAAGCTGGCTTAAGG + Intronic
1039494953 8:37973698-37973720 CACCACTCAAAGGTGGGGCATGG + Intergenic
1042105598 8:65323129-65323151 CTCCACTCAAATCTGTCTCAGGG + Intergenic
1047770677 8:128027734-128027756 CACTACTGAGTGCTGGCTCATGG + Intergenic
1048263491 8:132965373-132965395 CACTTCATAAAGCAGGCTCAAGG - Intronic
1056981461 9:91315749-91315771 CACCACTCAAAGCTAGATCTAGG + Intronic
1058885291 9:109318434-109318456 CACCACTTAAGCCTGTCTCATGG + Intronic
1059638158 9:116190806-116190828 CAGCGGTTATAGCTGGCTCATGG - Intronic
1062065689 9:134525069-134525091 CACCCCCAAAGGCTGGCTCAGGG + Intergenic
1186282312 X:8006376-8006398 CAACACTTATATCTTGCTCATGG - Intergenic
1186462049 X:9755559-9755581 CACTACTTAAAGCTGGCTCAGGG + Intronic
1187014077 X:15308644-15308666 CTCCACATGAAGCTGTCTCATGG + Intronic
1187103764 X:16220273-16220295 CAGCACTTAAAGCAAGCTCCTGG + Intergenic
1189925015 X:45944119-45944141 CCCCACTTAAAGTTTGGTCAAGG - Intergenic
1194721221 X:97342280-97342302 CACCACTGAAGGCTGGGTCATGG - Intronic
1201568904 Y:15393508-15393530 CAGCTCTTAAAGGTGGCACATGG + Intergenic
1202336861 Y:23821037-23821059 CAGCACTTTCAGCTGGCTCATGG + Intergenic
1202533904 Y:25849034-25849056 CAGCACTTTCAGCTGGCTCATGG - Intergenic