ID: 1085456547

View in Genome Browser
Species Human (GRCh38)
Location 11:76668762-76668784
Sequence GACCCTTCCTTGTCCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085456547_1085456557 27 Left 1085456547 11:76668762-76668784 CCAGGTGAGGACAAGGAAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 211
Right 1085456557 11:76668812-76668834 CAAACCCCACTCTATCCCCAAGG 0: 1
1: 0
2: 2
3: 17
4: 173
1085456547_1085456558 30 Left 1085456547 11:76668762-76668784 CCAGGTGAGGACAAGGAAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 211
Right 1085456558 11:76668815-76668837 ACCCCACTCTATCCCCAAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085456547 Original CRISPR GACCCTTCCTTGTCCTCACC TGG (reversed) Intronic
900430393 1:2598635-2598657 GACCCTCCCTGGGCCTCACCTGG + Exonic
900522081 1:3110710-3110732 GAACTTTCCTTCTCCTCACGTGG + Intronic
902830228 1:19007747-19007769 GAACCTTGTTTGTCCTCTCCTGG - Intergenic
903658487 1:24963178-24963200 CAGCCTTCCTTGGCCTCACCAGG + Intronic
905615516 1:39394932-39394954 GACCCTTCCTTGGCCTGTCTTGG + Intronic
906613798 1:47221493-47221515 GACCCTTCACTGTCTTCCCCTGG - Intronic
911062224 1:93758310-93758332 AACTCTTCTTTGTCCTCCCCTGG - Intronic
912506155 1:110157797-110157819 GTCTGTTCCTTGTACTCACCAGG + Intronic
913561670 1:120027248-120027270 GACCCTTAGGTGTCCTCTCCTGG + Intronic
913636454 1:120766349-120766371 GACCCTTAGGTGTCCTCTCCTGG - Intergenic
914282258 1:146186650-146186672 GACCCTTAGGTGTCCTCTCCTGG + Intronic
914543283 1:148637364-148637386 GACCCTTAGGTGTCCTCTCCTGG + Intronic
914623338 1:149433648-149433670 GACCCTTAGGTGTCCTCTCCTGG - Intergenic
916003985 1:160642761-160642783 GGCACTTCCATGTCCTCAGCTGG - Intronic
918127514 1:181597349-181597371 GCCCCTTCCTCTTCTTCACCAGG + Intronic
920497254 1:206463979-206464001 GACCCTTCAGAGTCCACACCAGG - Exonic
922351162 1:224735540-224735562 GACCCCTCCTCCTCTTCACCTGG - Intronic
924481513 1:244439545-244439567 GACTCTTCCTTCTCCTCAAGTGG + Intronic
1063282183 10:4642374-4642396 AAGCCTTCCTTGTCTTCTCCAGG - Intergenic
1063866156 10:10367432-10367454 GACCCTGCCATGTTGTCACCGGG - Intergenic
1065314666 10:24451638-24451660 GAACCTTCCTTCTCCCCAACAGG + Intronic
1067046217 10:42986555-42986577 TACCCTTCCATTTCCTGACCAGG + Intergenic
1070330201 10:75410821-75410843 GACCTGTCCTTCTCTTCACCTGG + Intergenic
1075418104 10:122280425-122280447 GAGCCCTCCTTGTCCCCAGCTGG + Intronic
1075625981 10:123964881-123964903 GACCCTTCCCTGTCCCCCCATGG - Intergenic
1076202925 10:128572718-128572740 GTCCTTGCCTTGTCCTCCCCTGG - Intergenic
1076584294 10:131534855-131534877 GGTCCTTCCCTGGCCTCACCTGG + Intergenic
1083299848 11:61734610-61734632 GGCCCTTCCCTCTCCCCACCTGG - Intronic
1084881166 11:72172613-72172635 GACCCGACTTTATCCTCACCTGG - Intergenic
1085456547 11:76668762-76668784 GACCCTTCCTTGTCCTCACCTGG - Intronic
1086365639 11:86107661-86107683 GACCATTCCTAGTCTTCCCCTGG - Intergenic
1086397245 11:86429239-86429261 GACCCCTTCTTCTCTTCACCTGG - Intergenic
1088581496 11:111320968-111320990 GATCCTTCCTTTTACTCCCCTGG - Intergenic
1092228336 12:6763536-6763558 AGACCTTCCTTGTTCTCACCTGG + Intronic
1094441231 12:30479242-30479264 GTTCCTTCCTTGTTCTGACCTGG - Intergenic
1096690843 12:53320982-53321004 TTCCCTTCCTTGTCCTTCCCAGG + Intronic
1096716224 12:53493079-53493101 GTCCCTTCCCTTTCCCCACCCGG - Intronic
1099205993 12:79727357-79727379 GCCCCATCCTTCTCCACACCAGG + Intergenic
1102212079 12:111134746-111134768 GAGTCTTCCTTGACCTCTCCAGG - Intronic
1105529217 13:21203097-21203119 AACCCTTCCTGGTGCCCACCAGG + Intergenic
1109972694 13:69789976-69789998 GAAACATCTTTGTCCTCACCAGG + Intronic
1110528995 13:76574756-76574778 GTCCTCTCCTTTTCCTCACCAGG - Intergenic
1112435610 13:99389620-99389642 GACCCACCATGGTCCTCACCCGG + Intergenic
1117782950 14:59253778-59253800 GACCCTGTCTAGGCCTCACCAGG + Intronic
1117840714 14:59857849-59857871 GAATCTTCCTTCTCCTCATCTGG + Intronic
1118037021 14:61878792-61878814 GACTCTTCCTAGTCCACAGCAGG - Intergenic
1119140532 14:72263367-72263389 GACCCAGCCTTGTCACCACCTGG + Intronic
1119512196 14:75220374-75220396 CACCCTTCCCTCTGCTCACCAGG + Intergenic
1119657105 14:76425117-76425139 GATCCTCCCCTCTCCTCACCAGG - Intronic
1122007257 14:98715901-98715923 GGCCCTTCCTGCTCCTCACGTGG - Intronic
1123025473 14:105421756-105421778 GACCCTGCCTTGTCCCATCCCGG + Intronic
1126088469 15:45030813-45030835 AAGCCTCCCCTGTCCTCACCAGG - Intronic
1127143152 15:55997175-55997197 AACCCTTCCTTGAACACACCTGG - Intergenic
1127920525 15:63490788-63490810 TGCTGTTCCTTGTCCTCACCAGG - Intergenic
1129879460 15:78997191-78997213 AACCCATGCTTGTCCTCTCCTGG - Intronic
1130259246 15:82342965-82342987 GAACCCTCCCTGTCCTCTCCCGG + Intronic
1130269430 15:82436200-82436222 GAACCCTCCCTGTCCTCTCCCGG - Intronic
1130275993 15:82476631-82476653 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1130282019 15:82526218-82526240 GAACCCTCCCTGTCCTCTCCCGG - Intergenic
1130468354 15:84204023-84204045 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1130473388 15:84242381-84242403 GAACCCTCCCTGTCCTCTCCCGG - Intronic
1130480802 15:84356445-84356467 GAACCCTCCCTGTCCTCTCCCGG - Intergenic
1130485394 15:84395733-84395755 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1130490910 15:84431314-84431336 GAACCCTCCCTGTCCTCTCCCGG + Intergenic
1130495912 15:84469519-84469541 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1130502494 15:84510113-84510135 GAACCCTCCCTGTCCTCTCCCGG + Intergenic
1130590647 15:85208621-85208643 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1131255514 15:90859499-90859521 CACCCTTCCTCCTCCCCACCAGG - Intergenic
1131799491 15:96054287-96054309 GACACTTCCCTGCCCTCCCCCGG + Intergenic
1132002486 15:98194048-98194070 GACCATTCCCTGACCTCCCCAGG + Intergenic
1135525760 16:23212612-23212634 GACCCTTCCTGGCCATCCCCAGG - Intronic
1136061912 16:27732491-27732513 GACACATGCTTGTCCTCCCCAGG - Intronic
1136499746 16:30664417-30664439 CACCCCTCCTTGTTCTCCCCTGG + Exonic
1138743317 16:59335365-59335387 CACCCTGCCTGGTCCTCACTCGG + Intergenic
1139100994 16:63766881-63766903 AAGCCTTGATTGTCCTCACCTGG - Intergenic
1140245052 16:73240629-73240651 GACCCTTATTTGACCTCAGCTGG + Intergenic
1141140031 16:81491257-81491279 GGCCCAGCCCTGTCCTCACCAGG - Intronic
1141622762 16:85245835-85245857 GAACTTTCCTGGTCCTCACTGGG + Intergenic
1142794402 17:2296380-2296402 AAGCCTTCCTTGGCCCCACCAGG + Intronic
1142996221 17:3761998-3762020 GTCCCCTCCTCCTCCTCACCTGG - Intronic
1147314537 17:39613264-39613286 GAGCCTTCCCTGACCTCCCCAGG + Intergenic
1147318344 17:39631743-39631765 GACCCTTCATTTTCCTGTCCTGG - Intronic
1147976226 17:44249694-44249716 GCCTGTACCTTGTCCTCACCAGG + Exonic
1148841975 17:50504659-50504681 GTACCTTCTGTGTCCTCACCTGG + Intergenic
1149305126 17:55340049-55340071 GACTCTTCCTTCCCTTCACCTGG - Intergenic
1151427940 17:74043301-74043323 GATTCTTCCTTTTCCTCCCCTGG - Intergenic
1152234350 17:79130690-79130712 GACCCAGGCTTGTCCCCACCGGG - Intronic
1157313281 18:46568339-46568361 GAATCTTCCTTGACATCACCTGG - Intronic
1159877666 18:73830038-73830060 GAACCTTCCTTGTCCTCTTGAGG + Intergenic
1160348330 18:78152994-78153016 GACCCTTCCTTATCCCCAGGTGG + Intergenic
1161039341 19:2101714-2101736 GGCCCTTCCTTCCCCTCCCCCGG + Exonic
1161268179 19:3374856-3374878 CATCCTCCCTTGTCCTCCCCAGG - Intronic
1162172815 19:8804747-8804769 CACCCTTCCTTTTCCTCTCAGGG + Intergenic
1168112367 19:54200634-54200656 GAACCTTCCTTCTCCGCCCCTGG - Intergenic
1168341290 19:55624465-55624487 GCCCCTTCCTTGCCCGCACCAGG + Exonic
927105376 2:19819251-19819273 GACCCTGCCTTGGCCTGAACTGG + Intergenic
927811093 2:26180524-26180546 GCCCCTTTCTTGGCCTCTCCAGG + Intronic
927825996 2:26310770-26310792 CACCCATCTTTGGCCTCACCTGG - Exonic
928384967 2:30859268-30859290 TTCTCTTCCTTTTCCTCACCTGG - Intergenic
931287428 2:60844462-60844484 AGCTCTTCCCTGTCCTCACCGGG + Intergenic
931441976 2:62296510-62296532 GAACCTGCCTTTTCCTCACCAGG + Intergenic
931590760 2:63880739-63880761 ACCCCTGCGTTGTCCTCACCTGG + Intronic
931808483 2:65830844-65830866 GACCCTTACTGGTCCACACAGGG + Intergenic
933778900 2:85787973-85787995 GCCCCTTCCTTGTGCTCAAATGG + Exonic
936055403 2:109258547-109258569 CACCAATCCTTGTCCTCACTAGG + Intronic
936462670 2:112724072-112724094 GACGCTGCCTTGTCCTTGCCAGG + Exonic
937825931 2:126368524-126368546 GACCCAGCCTCGTCCTGACCAGG - Intergenic
940416460 2:153428271-153428293 AAACCTTCCTAGGCCTCACCAGG - Intergenic
946249152 2:218402402-218402424 GCCTCTTCCTGGCCCTCACCTGG - Exonic
946855494 2:223945566-223945588 GACAATTCCTTGTCCCCTCCAGG - Intergenic
948422785 2:237870804-237870826 GGCCCTTCCGAGTCCTCACTTGG - Intronic
948459997 2:238124409-238124431 TGCCCTTCCCTCTCCTCACCAGG + Intronic
1169193684 20:3672518-3672540 GAACCTTCCATGCCCTCACCAGG + Exonic
1169218373 20:3806300-3806322 AACCCCTCCTTCCCCTCACCTGG + Intergenic
1170083409 20:12502102-12502124 CTCCCTTTCTTGTCCTCACAAGG - Intergenic
1170497680 20:16942288-16942310 GACCCTTCCTTTTGCTATCCTGG - Intergenic
1170775735 20:19373287-19373309 GGCCCTTCCTTGTCCTGCCCAGG + Intronic
1170893970 20:20397926-20397948 CACCGTTCCTTCTCCACACCTGG + Intronic
1172047356 20:32089967-32089989 GACCCTGCCTGGGCCTCAGCTGG + Intronic
1173023060 20:39284021-39284043 GGACCTTCCTTTTCCCCACCGGG - Intergenic
1173294990 20:41748311-41748333 TACCTTTCCTGCTCCTCACCAGG - Intergenic
1175230888 20:57472419-57472441 GCCCCTTCCTTGGCCTCCCAAGG - Intergenic
1175383728 20:58580917-58580939 CACTCTTCTTTGTCCACACCAGG + Intergenic
1178461155 21:32803448-32803470 CACCCCTCCTTGACCTCAACGGG - Intronic
1178521373 21:33290658-33290680 GACAATGCCTTGCCCTCACCAGG + Intronic
1178530351 21:33370810-33370832 GGCCCTCCCTTGTCCTATCCAGG + Intergenic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1184452725 22:44592534-44592556 GCCCCTCCCTTGCCCACACCTGG + Intergenic
1184662437 22:45971578-45971600 GCCCCTGCCGAGTCCTCACCTGG - Intronic
1185056962 22:48586164-48586186 CACCCTCCCTTGACCTCACTGGG - Intronic
1185314090 22:50171301-50171323 GGCCTTTCCTGGTCCCCACCTGG - Intronic
1185356533 22:50375570-50375592 CACCGTTCCTTGCCCTCATCTGG + Intronic
950716736 3:14853180-14853202 GATGCTTCCTTGTCCTCACAGGG - Intronic
951221711 3:20075714-20075736 GAAGCTTCCTTGCCCTCTCCAGG + Intronic
952206705 3:31187496-31187518 GACCCTGCCTTTTCCTAGCCCGG - Intergenic
952943607 3:38461001-38461023 GACCCCTCCTTCTCCTCAGATGG - Intronic
953231180 3:41066390-41066412 GTCCCTTCATGGTTCTCACCAGG + Intergenic
953250811 3:41244583-41244605 AACCCTTCCCTGCCCTCCCCAGG - Intronic
954156410 3:48687282-48687304 GACCCTGCCTTCTCTGCACCAGG + Intergenic
955923240 3:63980487-63980509 GAAGCTTCCTTCTCCTCATCTGG - Intronic
960870929 3:122249047-122249069 ACCCCTTCCTTGTCCTGTCCAGG + Intronic
961408729 3:126703399-126703421 GACCATTCCCTGTCCTCCCGGGG + Intergenic
961516728 3:127442655-127442677 CCTCGTTCCTTGTCCTCACCTGG + Intergenic
963899528 3:150720566-150720588 GTCTCTTCCTGTTCCTCACCAGG - Intergenic
967109118 3:186277761-186277783 TAGCCTTCCTCGTGCTCACCAGG + Intronic
968684871 4:1951200-1951222 GATGCTGCCTTCTCCTCACCTGG - Exonic
968872109 4:3247425-3247447 GACCGGTCCCTGACCTCACCGGG + Intronic
975365628 4:73524489-73524511 TACCATTCCCTTTCCTCACCTGG + Intergenic
983100418 4:163618994-163619016 GACACATCCTTGTCCTTGCCTGG - Intronic
984855791 4:184194920-184194942 GACCTTTCCTAGACCTCAGCAGG + Intronic
985552675 5:541410-541432 GCCCCTTCCTTGACCTGTCCGGG - Intergenic
985719290 5:1480976-1480998 GACCCTGCCTCTTCCTCCCCAGG - Exonic
985884041 5:2662512-2662534 GACCCTGCCTGGTTCTGACCAGG + Intergenic
986480411 5:8181025-8181047 TTCCCTTCCTCCTCCTCACCAGG + Intergenic
987631176 5:20474416-20474438 GAAGTTTCCTTCTCCTCACCTGG + Intronic
988685832 5:33524492-33524514 GGCCCTTCTTTCTTCTCACCTGG - Exonic
992663684 5:78985242-78985264 GACCCATCCTTGTCCGCCCGCGG + Exonic
992907473 5:81360657-81360679 GACCCTTCCTTCTACACACAGGG - Intronic
997654638 5:135545911-135545933 GACCCTTCCTCCTCCCCTCCTGG + Intergenic
999845555 5:155475591-155475613 GACATGTCCTTATCCTCACCTGG - Intergenic
1001527884 5:172441631-172441653 AACCCTTCCGTTACCTCACCAGG - Intronic
1001631935 5:173181994-173182016 GACCCTTACTTTTCCCCACAGGG + Intergenic
1002653660 5:180724111-180724133 GTCACTTCCTTCTCCACACCTGG - Intergenic
1006029665 6:31170097-31170119 GACCCTGCCTGCTCCTCTCCTGG + Intronic
1007415220 6:41687700-41687722 CCCTCTTCCTTGTTCTCACCTGG - Intronic
1010035694 6:71323727-71323749 GACCCTTACTCCCCCTCACCAGG + Intergenic
1010410299 6:75553925-75553947 CACCCTTCCTTGTGTTCAGCAGG + Intergenic
1011436206 6:87339896-87339918 GACTCTTGCTTCTCCTCTCCAGG - Intronic
1011471325 6:87710614-87710636 GACAATTCCTTGTACTCATCTGG - Intergenic
1012815530 6:104018166-104018188 GTCCCTTGCTTGTCCTCAGATGG - Intergenic
1012816941 6:104035234-104035256 TCCCCTTCCTTCTCCTCTCCTGG - Intergenic
1018969670 6:168517727-168517749 GACCCCGCCTTTTCCTCAGCTGG + Intronic
1019538973 7:1543121-1543143 GACCCTGCCTGTCCCTCACCGGG + Exonic
1019712885 7:2525395-2525417 GGCCCTGCCTTGTCCTCAGGTGG + Exonic
1021488306 7:21190879-21190901 GACCCTGCTTTGTCCTTTCCTGG - Intergenic
1022234951 7:28452559-28452581 GATCCTTCCTCATCCTCAGCTGG - Intronic
1023207862 7:37770396-37770418 CTTGCTTCCTTGTCCTCACCAGG + Intronic
1023534724 7:41196265-41196287 GACCCTACAAAGTCCTCACCTGG - Intergenic
1025028522 7:55537178-55537200 GACCCTGCCCTGTCCCAACCAGG + Intronic
1025734022 7:64131343-64131365 CACCCTTTCTCGCCCTCACCAGG - Intronic
1028849990 7:95527569-95527591 AATCCTTCCTTCTCCTCCCCTGG + Intronic
1029160744 7:98549616-98549638 CTCCCTTCCCTGTCCTCACCAGG + Intergenic
1029408195 7:100390386-100390408 GACCCTCCCCTCTCCTCCCCAGG - Intronic
1029528439 7:101109505-101109527 GACCCTTCCTTGTCTGCTCCAGG + Intergenic
1029696181 7:102214724-102214746 CTCCCCTCCTTATCCTCACCGGG - Intronic
1030012954 7:105189447-105189469 TACACTTCCTTCTCCTCAGCTGG - Intronic
1031368703 7:120937242-120937264 GACTCTTCCTTGAACACACCAGG - Intergenic
1032341620 7:131079277-131079299 GGCCCTTCCCCGTGCTCACCTGG + Intergenic
1032343172 7:131094721-131094743 GAATCTTCCTAGTCCTCAACAGG - Intergenic
1032391951 7:131560994-131561016 GAGCCTTCCTTGACCTCCCCGGG - Intergenic
1034897323 7:154885898-154885920 GACCCTTCCCTCTCCTTCCCCGG - Intronic
1035345069 7:158192302-158192324 GACCCTTCCACTTCCTCCCCGGG - Intronic
1036807796 8:11847295-11847317 GAGCCTTCCTTGAGCTCCCCTGG - Intronic
1038282779 8:26180981-26181003 TCCCCTTCTGTGTCCTCACCTGG - Intergenic
1038413455 8:27375877-27375899 GAGCCTTCATTCCCCTCACCAGG + Intronic
1038686340 8:29721975-29721997 GACCCTTCCATGGACTCAGCAGG - Intergenic
1039079112 8:33718529-33718551 GCCCCTCCCTCGTCCTCCCCTGG + Intergenic
1039219423 8:35312163-35312185 GATGCCTCCTTGTCATCACCCGG + Intronic
1040683710 8:49844450-49844472 CCCCTTTCCTTGTCCTCAGCTGG - Intergenic
1041487957 8:58399725-58399747 AACCCTTCCATCTCCTCTCCAGG + Intergenic
1041578958 8:59434478-59434500 GACCCGTCCTCCTCCTCTCCTGG + Intergenic
1044394038 8:91688392-91688414 GAAGCTTCCATGTCCTCCCCAGG + Intergenic
1044413852 8:91914047-91914069 GACACATCCTTGTCCTCAAGAGG - Intergenic
1048437707 8:134433343-134433365 GACCCTTCCTCCTCCTGACCTGG - Intergenic
1049425157 8:142534770-142534792 GGCCCCTTCTTATCCTCACCTGG + Intronic
1049832792 8:144713094-144713116 GCCCCTTCCTTGCCCGGACCCGG + Intergenic
1051149979 9:14069684-14069706 TGCCCTTCCTTGTCCCCACATGG + Intergenic
1056792406 9:89634270-89634292 GACACGTCCTTGTGCTCTCCTGG + Intergenic
1058435580 9:104959767-104959789 CACCCTTCCCTGTCCTTCCCTGG + Intergenic
1060297255 9:122351137-122351159 GCCGCGTCATTGTCCTCACCTGG + Intergenic
1061223395 9:129265732-129265754 CACCCTTCCTTGTCAACTCCAGG - Intergenic
1061897706 9:133657048-133657070 GGCTGTTCCTTGTCCCCACCAGG + Exonic
1062440351 9:136566871-136566893 GCCTCTGCCTTTTCCTCACCCGG - Intergenic
1062630345 9:137460497-137460519 TGCCCTGCCTGGTCCTCACCTGG - Intronic
1189005212 X:36986982-36987004 GCCCCTTCCTTGCCTTAACCTGG - Intergenic
1189043817 X:37570960-37570982 GCCCCTTCCTTGCCTTAACCTGG + Intronic
1189256768 X:39645826-39645848 TACCCTTCCTTGTCTTCATGGGG - Intergenic
1192554983 X:72082149-72082171 GACCTATTCTTGTGCTCACCTGG - Intergenic
1192812260 X:74557853-74557875 CACCCTTCCTTTCCATCACCAGG + Intergenic
1197163921 X:123354960-123354982 GACACTTGCTTGTTCTTACCAGG - Exonic
1200889092 Y:8303717-8303739 GACCCTCCCTTAACCTCACTGGG - Intergenic
1202367329 Y:24174284-24174306 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1202503452 Y:25495839-25495861 GAACCCTCCCTGTCCTCTCCTGG + Intergenic