ID: 1085457611

View in Genome Browser
Species Human (GRCh38)
Location 11:76674133-76674155
Sequence CCTAGAAGGCAGGGCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085457611_1085457617 -10 Left 1085457611 11:76674133-76674155 CCTTCTGGGCCCTGCCTTCTAGG No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085457611 Original CRISPR CCTAGAAGGCAGGGCCCAGA AGG (reversed) Intergenic
No off target data available for this crispr