ID: 1085457617

View in Genome Browser
Species Human (GRCh38)
Location 11:76674146-76674168
Sequence GCCTTCTAGGGCAGAACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085457603_1085457617 21 Left 1085457603 11:76674102-76674124 CCCTGAGAGTCTGGGAGTTCCCT No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data
1085457610_1085457617 -9 Left 1085457610 11:76674132-76674154 CCCTTCTGGGCCCTGCCTTCTAG No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data
1085457608_1085457617 1 Left 1085457608 11:76674122-76674144 CCTCACGAGCCCCTTCTGGGCCC No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data
1085457607_1085457617 2 Left 1085457607 11:76674121-76674143 CCCTCACGAGCCCCTTCTGGGCC No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data
1085457604_1085457617 20 Left 1085457604 11:76674103-76674125 CCTGAGAGTCTGGGAGTTCCCTC No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data
1085457611_1085457617 -10 Left 1085457611 11:76674133-76674155 CCTTCTGGGCCCTGCCTTCTAGG No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data
1085457609_1085457617 -8 Left 1085457609 11:76674131-76674153 CCCCTTCTGGGCCCTGCCTTCTA No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data
1085457602_1085457617 22 Left 1085457602 11:76674101-76674123 CCCCTGAGAGTCTGGGAGTTCCC No data
Right 1085457617 11:76674146-76674168 GCCTTCTAGGGCAGAACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085457617 Original CRISPR GCCTTCTAGGGCAGAACCCT GGG Intergenic
No off target data available for this crispr