ID: 1085458183

View in Genome Browser
Species Human (GRCh38)
Location 11:76677636-76677658
Sequence CCTTCAGAGGGATTGGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085458183_1085458191 -5 Left 1085458183 11:76677636-76677658 CCCCAAGCCAATCCCTCTGAAGG No data
Right 1085458191 11:76677654-76677676 GAAGGTCTGGAAGCTTAAAAAGG No data
1085458183_1085458195 12 Left 1085458183 11:76677636-76677658 CCCCAAGCCAATCCCTCTGAAGG No data
Right 1085458195 11:76677671-76677693 AAAAGGGGTTATGTGGCCTCAGG No data
1085458183_1085458192 -4 Left 1085458183 11:76677636-76677658 CCCCAAGCCAATCCCTCTGAAGG No data
Right 1085458192 11:76677655-76677677 AAGGTCTGGAAGCTTAAAAAGGG No data
1085458183_1085458194 5 Left 1085458183 11:76677636-76677658 CCCCAAGCCAATCCCTCTGAAGG No data
Right 1085458194 11:76677664-76677686 AAGCTTAAAAAGGGGTTATGTGG No data
1085458183_1085458193 -3 Left 1085458183 11:76677636-76677658 CCCCAAGCCAATCCCTCTGAAGG No data
Right 1085458193 11:76677656-76677678 AGGTCTGGAAGCTTAAAAAGGGG No data
1085458183_1085458196 13 Left 1085458183 11:76677636-76677658 CCCCAAGCCAATCCCTCTGAAGG No data
Right 1085458196 11:76677672-76677694 AAAGGGGTTATGTGGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085458183 Original CRISPR CCTTCAGAGGGATTGGCTTG GGG (reversed) Intergenic