ID: 1085460080

View in Genome Browser
Species Human (GRCh38)
Location 11:76688318-76688340
Sequence GCTGCTCACCACCTGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085460080_1085460088 7 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460088 11:76688348-76688370 GGCAGGAGAGGCCGGGCCAAGGG No data
1085460080_1085460089 8 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460089 11:76688349-76688371 GCAGGAGAGGCCGGGCCAAGGGG No data
1085460080_1085460090 12 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460090 11:76688353-76688375 GAGAGGCCGGGCCAAGGGGCAGG No data
1085460080_1085460084 -5 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460084 11:76688336-76688358 GCAGCAGAAGGTGGCAGGAGAGG No data
1085460080_1085460087 6 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460087 11:76688347-76688369 TGGCAGGAGAGGCCGGGCCAAGG No data
1085460080_1085460092 18 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460092 11:76688359-76688381 CCGGGCCAAGGGGCAGGCACTGG No data
1085460080_1085460085 -1 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460085 11:76688340-76688362 CAGAAGGTGGCAGGAGAGGCCGG No data
1085460080_1085460083 -10 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460083 11:76688331-76688353 GGTGAGCAGCAGAAGGTGGCAGG No data
1085460080_1085460093 22 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460093 11:76688363-76688385 GCCAAGGGGCAGGCACTGGCTGG No data
1085460080_1085460086 0 Left 1085460080 11:76688318-76688340 CCTGTGAGCAGGTGGTGAGCAGC No data
Right 1085460086 11:76688341-76688363 AGAAGGTGGCAGGAGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085460080 Original CRISPR GCTGCTCACCACCTGCTCAC AGG (reversed) Intergenic
No off target data available for this crispr