ID: 1085460722

View in Genome Browser
Species Human (GRCh38)
Location 11:76691661-76691683
Sequence GGGCATCGAAGAGACCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085460722_1085460736 8 Left 1085460722 11:76691661-76691683 CCCAGTAGGTCTCTTCGATGCCC No data
Right 1085460736 11:76691692-76691714 GAAGAGAGAGGGAAGGGGATGGG No data
1085460722_1085460737 12 Left 1085460722 11:76691661-76691683 CCCAGTAGGTCTCTTCGATGCCC No data
Right 1085460737 11:76691696-76691718 AGAGAGGGAAGGGGATGGGAAGG No data
1085460722_1085460729 1 Left 1085460722 11:76691661-76691683 CCCAGTAGGTCTCTTCGATGCCC No data
Right 1085460729 11:76691685-76691707 TCCCCTGGAAGAGAGAGGGAAGG No data
1085460722_1085460727 -3 Left 1085460722 11:76691661-76691683 CCCAGTAGGTCTCTTCGATGCCC No data
Right 1085460727 11:76691681-76691703 CCCTTCCCCTGGAAGAGAGAGGG No data
1085460722_1085460725 -4 Left 1085460722 11:76691661-76691683 CCCAGTAGGTCTCTTCGATGCCC No data
Right 1085460725 11:76691680-76691702 GCCCTTCCCCTGGAAGAGAGAGG No data
1085460722_1085460731 2 Left 1085460722 11:76691661-76691683 CCCAGTAGGTCTCTTCGATGCCC No data
Right 1085460731 11:76691686-76691708 CCCCTGGAAGAGAGAGGGAAGGG No data
1085460722_1085460735 7 Left 1085460722 11:76691661-76691683 CCCAGTAGGTCTCTTCGATGCCC No data
Right 1085460735 11:76691691-76691713 GGAAGAGAGAGGGAAGGGGATGG No data
1085460722_1085460733 3 Left 1085460722 11:76691661-76691683 CCCAGTAGGTCTCTTCGATGCCC No data
Right 1085460733 11:76691687-76691709 CCCTGGAAGAGAGAGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085460722 Original CRISPR GGGCATCGAAGAGACCTACT GGG (reversed) Intergenic
No off target data available for this crispr