ID: 1085462375

View in Genome Browser
Species Human (GRCh38)
Location 11:76701949-76701971
Sequence CAGACATGGTAGGGAAGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085462375_1085462380 -1 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data
1085462375_1085462390 18 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462390 11:76701990-76702012 CTGGATCAGAACGAGGAGAAGGG No data
1085462375_1085462393 24 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG No data
1085462375_1085462384 11 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462384 11:76701983-76702005 AGACCCCCTGGATCAGAACGAGG No data
1085462375_1085462392 23 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462392 11:76701995-76702017 TCAGAACGAGGAGAAGGGTTGGG No data
1085462375_1085462394 28 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462375_1085462391 22 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462391 11:76701994-76702016 ATCAGAACGAGGAGAAGGGTTGG No data
1085462375_1085462389 17 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085462375 Original CRISPR CAGACATGGTAGGGAAGGTA CGG (reversed) Intergenic
No off target data available for this crispr