ID: 1085462376

View in Genome Browser
Species Human (GRCh38)
Location 11:76701954-76701976
Sequence AGCTTCAGACATGGTAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085462376_1085462392 18 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462392 11:76701995-76702017 TCAGAACGAGGAGAAGGGTTGGG No data
1085462376_1085462380 -6 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data
1085462376_1085462389 12 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data
1085462376_1085462395 27 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462395 11:76702004-76702026 GGAGAAGGGTTGGGGTTGGAAGG No data
1085462376_1085462384 6 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462384 11:76701983-76702005 AGACCCCCTGGATCAGAACGAGG No data
1085462376_1085462391 17 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462391 11:76701994-76702016 ATCAGAACGAGGAGAAGGGTTGG No data
1085462376_1085462394 23 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462376_1085462390 13 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462390 11:76701990-76702012 CTGGATCAGAACGAGGAGAAGGG No data
1085462376_1085462393 19 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085462376 Original CRISPR AGCTTCAGACATGGTAGGGA AGG (reversed) Intergenic
No off target data available for this crispr