ID: 1085462380

View in Genome Browser
Species Human (GRCh38)
Location 11:76701971-76701993
Sequence GAAGCTGCCCCTAGACCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085462373_1085462380 6 Left 1085462373 11:76701942-76701964 CCTTCCTCCGTACCTTCCCTACC No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data
1085462372_1085462380 13 Left 1085462372 11:76701935-76701957 CCTGGGACCTTCCTCCGTACCTT No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data
1085462377_1085462380 -10 Left 1085462377 11:76701958-76701980 CCCTACCATGTCTGAAGCTGCCC No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data
1085462371_1085462380 29 Left 1085462371 11:76701919-76701941 CCTTGGTGTGTTGTTTCCTGGGA No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data
1085462375_1085462380 -1 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data
1085462376_1085462380 -6 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data
1085462374_1085462380 2 Left 1085462374 11:76701946-76701968 CCTCCGTACCTTCCCTACCATGT No data
Right 1085462380 11:76701971-76701993 GAAGCTGCCCCTAGACCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085462380 Original CRISPR GAAGCTGCCCCTAGACCCCC TGG Intergenic
No off target data available for this crispr