ID: 1085462382

View in Genome Browser
Species Human (GRCh38)
Location 11:76701979-76702001
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085462382_1085462396 16 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462396 11:76702018-76702040 GTTGGAAGGTCCCCACAGCATGG No data
1085462382_1085462397 17 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462397 11:76702019-76702041 TTGGAAGGTCCCCACAGCATGGG No data
1085462382_1085462392 -7 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462392 11:76701995-76702017 TCAGAACGAGGAGAAGGGTTGGG No data
1085462382_1085462394 -2 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462382_1085462395 2 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462395 11:76702004-76702026 GGAGAAGGGTTGGGGTTGGAAGG No data
1085462382_1085462398 25 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462398 11:76702027-76702049 TCCCCACAGCATGGGCAGAGTGG No data
1085462382_1085462393 -6 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG No data
1085462382_1085462391 -8 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462391 11:76701994-76702016 ATCAGAACGAGGAGAAGGGTTGG No data
1085462382_1085462402 28 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462402 11:76702030-76702052 CCACAGCATGGGCAGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085462382 Original CRISPR GTTCTGATCCAGGGGGTCTA GGG (reversed) Intergenic
No off target data available for this crispr