ID: 1085462389

View in Genome Browser
Species Human (GRCh38)
Location 11:76701989-76702011
Sequence CCTGGATCAGAACGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085462374_1085462389 20 Left 1085462374 11:76701946-76701968 CCTCCGTACCTTCCCTACCATGT No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data
1085462379_1085462389 3 Left 1085462379 11:76701963-76701985 CCATGTCTGAAGCTGCCCCTAGA No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data
1085462375_1085462389 17 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data
1085462377_1085462389 8 Left 1085462377 11:76701958-76701980 CCCTACCATGTCTGAAGCTGCCC No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data
1085462378_1085462389 7 Left 1085462378 11:76701959-76701981 CCTACCATGTCTGAAGCTGCCCC No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data
1085462376_1085462389 12 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data
1085462373_1085462389 24 Left 1085462373 11:76701942-76701964 CCTTCCTCCGTACCTTCCCTACC No data
Right 1085462389 11:76701989-76702011 CCTGGATCAGAACGAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085462389 Original CRISPR CCTGGATCAGAACGAGGAGA AGG Intergenic
No off target data available for this crispr