ID: 1085462394

View in Genome Browser
Species Human (GRCh38)
Location 11:76702000-76702022
Sequence ACGAGGAGAAGGGTTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085462378_1085462394 18 Left 1085462378 11:76701959-76701981 CCTACCATGTCTGAAGCTGCCCC No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462383_1085462394 -3 Left 1085462383 11:76701980-76702002 CCTAGACCCCCTGGATCAGAACG No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462379_1085462394 14 Left 1085462379 11:76701963-76701985 CCATGTCTGAAGCTGCCCCTAGA No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462376_1085462394 23 Left 1085462376 11:76701954-76701976 CCTTCCCTACCATGTCTGAAGCT No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462385_1085462394 -9 Left 1085462385 11:76701986-76702008 CCCCCTGGATCAGAACGAGGAGA No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462386_1085462394 -10 Left 1085462386 11:76701987-76702009 CCCCTGGATCAGAACGAGGAGAA No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462382_1085462394 -2 Left 1085462382 11:76701979-76702001 CCCTAGACCCCCTGGATCAGAAC No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462375_1085462394 28 Left 1085462375 11:76701949-76701971 CCGTACCTTCCCTACCATGTCTG No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462377_1085462394 19 Left 1085462377 11:76701958-76701980 CCCTACCATGTCTGAAGCTGCCC No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data
1085462381_1085462394 -1 Left 1085462381 11:76701978-76702000 CCCCTAGACCCCCTGGATCAGAA No data
Right 1085462394 11:76702000-76702022 ACGAGGAGAAGGGTTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085462394 Original CRISPR ACGAGGAGAAGGGTTGGGGT TGG Intergenic
No off target data available for this crispr