ID: 1085465814

View in Genome Browser
Species Human (GRCh38)
Location 11:76722521-76722543
Sequence AGGTGTGTATGCAGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085465814_1085465825 11 Left 1085465814 11:76722521-76722543 CCCTGTGCCCTGCATACACACCT No data
Right 1085465825 11:76722555-76722577 GACTCAGGCTGCTCACGGCTGGG No data
1085465814_1085465824 10 Left 1085465814 11:76722521-76722543 CCCTGTGCCCTGCATACACACCT No data
Right 1085465824 11:76722554-76722576 AGACTCAGGCTGCTCACGGCTGG No data
1085465814_1085465818 -4 Left 1085465814 11:76722521-76722543 CCCTGTGCCCTGCATACACACCT No data
Right 1085465818 11:76722540-76722562 ACCTGTCTCCCACCAGACTCAGG No data
1085465814_1085465826 12 Left 1085465814 11:76722521-76722543 CCCTGTGCCCTGCATACACACCT No data
Right 1085465826 11:76722556-76722578 ACTCAGGCTGCTCACGGCTGGGG No data
1085465814_1085465822 6 Left 1085465814 11:76722521-76722543 CCCTGTGCCCTGCATACACACCT No data
Right 1085465822 11:76722550-76722572 CACCAGACTCAGGCTGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085465814 Original CRISPR AGGTGTGTATGCAGGGCACA GGG (reversed) Intergenic
No off target data available for this crispr