ID: 1085466027

View in Genome Browser
Species Human (GRCh38)
Location 11:76723912-76723934
Sequence CCTTGGCTGCAGGGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085466027_1085466035 2 Left 1085466027 11:76723912-76723934 CCCTGCAGCCCCTGCAGCCAAGG No data
Right 1085466035 11:76723937-76723959 CATCCTTCTGTCCTTCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085466027 Original CRISPR CCTTGGCTGCAGGGGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr