ID: 1085466407

View in Genome Browser
Species Human (GRCh38)
Location 11:76726678-76726700
Sequence TTGAGTAAGCACGGGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085466393_1085466407 19 Left 1085466393 11:76726636-76726658 CCAATGCAAGTCTCCATTCTGAA No data
Right 1085466407 11:76726678-76726700 TTGAGTAAGCACGGGGAGGGGGG No data
1085466397_1085466407 -6 Left 1085466397 11:76726661-76726683 CCATGGCCACACGGCCATTGAGT No data
Right 1085466407 11:76726678-76726700 TTGAGTAAGCACGGGGAGGGGGG No data
1085466395_1085466407 6 Left 1085466395 11:76726649-76726671 CCATTCTGAATGCCATGGCCACA No data
Right 1085466407 11:76726678-76726700 TTGAGTAAGCACGGGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085466407 Original CRISPR TTGAGTAAGCACGGGGAGGG GGG Intergenic
No off target data available for this crispr