ID: 1085466740

View in Genome Browser
Species Human (GRCh38)
Location 11:76729142-76729164
Sequence CCTCATGTCCTGTAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085466740_1085466744 -10 Left 1085466740 11:76729142-76729164 CCCTGCACCTACAGGACATGAGG No data
Right 1085466744 11:76729155-76729177 GGACATGAGGTACTCCTTCAAGG No data
1085466740_1085466745 -2 Left 1085466740 11:76729142-76729164 CCCTGCACCTACAGGACATGAGG No data
Right 1085466745 11:76729163-76729185 GGTACTCCTTCAAGGTGTCATGG No data
1085466740_1085466747 12 Left 1085466740 11:76729142-76729164 CCCTGCACCTACAGGACATGAGG No data
Right 1085466747 11:76729177-76729199 GTGTCATGGAAGCCTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085466740 Original CRISPR CCTCATGTCCTGTAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr