ID: 1085468590

View in Genome Browser
Species Human (GRCh38)
Location 11:76741441-76741463
Sequence AAATCTAGGGCGCAAGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085468586_1085468590 19 Left 1085468586 11:76741399-76741421 CCTACGAACATGTGTGTAAATAT No data
Right 1085468590 11:76741441-76741463 AAATCTAGGGCGCAAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085468590 Original CRISPR AAATCTAGGGCGCAAGGCTC TGG Intergenic