ID: 1085468822

View in Genome Browser
Species Human (GRCh38)
Location 11:76743715-76743737
Sequence CCAAGCAAACATTAGTACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085468822_1085468826 -7 Left 1085468822 11:76743715-76743737 CCGATGTACTAATGTTTGCTTGG No data
Right 1085468826 11:76743731-76743753 TGCTTGGGTTTGGCCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085468822 Original CRISPR CCAAGCAAACATTAGTACAT CGG (reversed) Intergenic
No off target data available for this crispr