ID: 1085472891

View in Genome Browser
Species Human (GRCh38)
Location 11:76769376-76769398
Sequence CTCAAATCTCAGCCGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085472891_1085472898 -1 Left 1085472891 11:76769376-76769398 CCCTGGCCCGGCTGAGATTTGAG No data
Right 1085472898 11:76769398-76769420 GCCCAGGTCAGGTGACTGCTGGG No data
1085472891_1085472897 -2 Left 1085472891 11:76769376-76769398 CCCTGGCCCGGCTGAGATTTGAG No data
Right 1085472897 11:76769397-76769419 AGCCCAGGTCAGGTGACTGCTGG No data
1085472891_1085472901 7 Left 1085472891 11:76769376-76769398 CCCTGGCCCGGCTGAGATTTGAG No data
Right 1085472901 11:76769406-76769428 CAGGTGACTGCTGGGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085472891 Original CRISPR CTCAAATCTCAGCCGGGCCA GGG (reversed) Intergenic
No off target data available for this crispr