ID: 1085474819

View in Genome Browser
Species Human (GRCh38)
Location 11:76783256-76783278
Sequence CCCTGCCGGGCGCCGGGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 303}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085474819_1085474830 -7 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474830 11:76783272-76783294 GGCAGGGGGGAGCCTGGCTGCGG 0: 1
1: 0
2: 9
3: 99
4: 1048
1085474819_1085474841 11 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474841 11:76783290-76783312 TGCGGGCGGGGACCGGGGGGCGG 0: 1
1: 0
2: 8
3: 117
4: 1162
1085474819_1085474838 6 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474838 11:76783285-76783307 CTGGCTGCGGGCGGGGACCGGGG 0: 1
1: 0
2: 5
3: 43
4: 437
1085474819_1085474831 -6 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474831 11:76783273-76783295 GCAGGGGGGAGCCTGGCTGCGGG 0: 1
1: 0
2: 4
3: 62
4: 696
1085474819_1085474833 -2 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474833 11:76783277-76783299 GGGGGAGCCTGGCTGCGGGCGGG 0: 1
1: 0
2: 3
3: 59
4: 670
1085474819_1085474839 7 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474839 11:76783286-76783308 TGGCTGCGGGCGGGGACCGGGGG 0: 1
1: 0
2: 3
3: 46
4: 389
1085474819_1085474844 25 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474844 11:76783304-76783326 GGGGGGCGGGCCGCGCCGCGCGG 0: 1
1: 0
2: 7
3: 108
4: 750
1085474819_1085474837 5 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474837 11:76783284-76783306 CCTGGCTGCGGGCGGGGACCGGG 0: 1
1: 1
2: 3
3: 45
4: 457
1085474819_1085474832 -3 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474832 11:76783276-76783298 GGGGGGAGCCTGGCTGCGGGCGG 0: 1
1: 0
2: 7
3: 161
4: 1064
1085474819_1085474840 8 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474840 11:76783287-76783309 GGCTGCGGGCGGGGACCGGGGGG 0: 1
1: 0
2: 13
3: 101
4: 801
1085474819_1085474842 12 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474819_1085474835 4 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474835 11:76783283-76783305 GCCTGGCTGCGGGCGGGGACCGG 0: 1
1: 0
2: 6
3: 52
4: 498
1085474819_1085474834 -1 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474834 11:76783278-76783300 GGGGAGCCTGGCTGCGGGCGGGG 0: 1
1: 0
2: 3
3: 59
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085474819 Original CRISPR CCCTGCCGGGCGCCGGGTGG CGG (reversed) Intronic
900409117 1:2504915-2504937 CCCAGCCGGGCCCAGGCTGGTGG - Exonic
900556674 1:3284113-3284135 CCCGGGCGGGCTACGGGTGGCGG - Intronic
900580250 1:3405187-3405209 CCCTGGCGGGCTCGGGGTGGAGG - Intronic
901079018 1:6573167-6573189 CCCGGCCGGGCACCGGGCGCGGG + Intronic
901138847 1:7014809-7014831 GCATGTCGGGGGCCGGGTGGGGG + Intronic
901526052 1:9824001-9824023 CCCGGCCGGGGGCGGGGTGGCGG + Exonic
904461833 1:30685303-30685325 CCCTGCCGGTCGCCGCGCGGTGG - Intergenic
906422320 1:45679944-45679966 CCCAGCAGGGCGGGGGGTGGGGG + Intronic
907185026 1:52602719-52602741 CCGGGCCGGGCGCGGGATGGGGG - Intronic
907589794 1:55655374-55655396 CTCTCCCGGGCACAGGGTGGTGG - Intergenic
912381353 1:109249746-109249768 CCTTGCCGGGCCCCGGGTTCCGG - Intergenic
912796283 1:112695523-112695545 CCCTGCTGGGGGCCAGGAGGCGG - Exonic
913009545 1:114669888-114669910 CCCTTCTGGGCGTCGGGTGCGGG - Intronic
914869127 1:151458824-151458846 CCGCGGCGGGCGCCGGGGGGCGG + Intronic
916694321 1:167221102-167221124 CCCCGCCGGGCGCTGAGCGGAGG + Intronic
916694429 1:167221422-167221444 GCCGGGCGGGCGCGGGGTGGGGG + Intronic
916890095 1:169106053-169106075 CCCAGCCGGGAGCTGGGAGGGGG + Intronic
919916842 1:202144320-202144342 CACGGCCGGGCGCCGGGCGGGGG - Intronic
920616401 1:207496530-207496552 CCCGGCAGGGCGGCGGGTGTAGG + Intronic
921390294 1:214608242-214608264 CCAGGCCGGGGGCCGGGGGGCGG - Intronic
921443752 1:215220356-215220378 CCCTGCAGGGTTCCTGGTGGTGG - Intronic
1065342909 10:24723435-24723457 CCCGGCCGGGCGCTGGCTCGGGG - Intronic
1065972745 10:30818266-30818288 CCCTGCAGGCTGGCGGGTGGAGG + Intergenic
1067339142 10:45387053-45387075 GCGTGCCAGGCGCCGTGTGGAGG + Intronic
1070949545 10:80419882-80419904 CCCTGCTGGGCACTGGCTGGGGG + Intronic
1073471928 10:103727787-103727809 CCCTGAGGGGAGCCGCGTGGAGG + Intronic
1075082184 10:119391526-119391548 CCCTGCAGGTTGCGGGGTGGTGG - Intronic
1076371568 10:129959217-129959239 GCCTGGCGGGCGCCCGGGGGAGG - Intronic
1076683172 10:132185750-132185772 CGCTGCCGGGCGGCAGGAGGCGG + Intergenic
1076729791 10:132432519-132432541 CTCTGCTGGGCACAGGGTGGTGG - Intergenic
1076791062 10:132776963-132776985 CCCTGGCCGGCGGTGGGTGGTGG + Intronic
1076930664 10:133529707-133529729 CTCTGCGGGGCGCGGGCTGGTGG + Intronic
1077012242 11:384535-384557 GCCTACAGGGGGCCGGGTGGGGG - Intergenic
1077152542 11:1078673-1078695 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152564 11:1078741-1078763 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152585 11:1078806-1078828 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152619 11:1078908-1078930 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152652 11:1079007-1079029 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152664 11:1079041-1079063 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152688 11:1079109-1079131 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152731 11:1079242-1079264 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152791 11:1079440-1079462 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152813 11:1079505-1079527 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152836 11:1079570-1079592 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152848 11:1079604-1079626 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077152898 11:1079771-1079793 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077153011 11:1080133-1080155 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077153276 11:1080926-1080948 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077153351 11:1081152-1081174 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077153447 11:1081440-1081462 CCGTGCCGGGCACCGGGAGCTGG + Intergenic
1077227184 11:1443468-1443490 CCCTGCGGGCGGCCGGGTGTGGG - Exonic
1078189030 11:9076207-9076229 CCCTGCCAGGGGCAGGGAGGAGG + Intronic
1078190901 11:9091746-9091768 CCCTCCCCGGCCTCGGGTGGAGG + Intronic
1078256540 11:9663784-9663806 CACTGCGGGGCGCTGGGAGGAGG + Intergenic
1079071719 11:17352964-17352986 CGCTCCTGGGTGCCGGGTGGTGG + Intronic
1079284654 11:19117541-19117563 CCCCGCCGGGCTCCGGGTACCGG - Intronic
1080388640 11:31825117-31825139 CCCAGCCTGGGGCGGGGTGGGGG - Intronic
1083203571 11:61134148-61134170 CTCTGCCAGGCTCCGGTTGGTGG + Exonic
1083664594 11:64267583-64267605 CCAGGGCGGGCGCTGGGTGGAGG + Intronic
1084153646 11:67302647-67302669 CCCTGAGGGGCGGAGGGTGGGGG - Intergenic
1084366539 11:68704991-68705013 CTCTGCCGGGGGCCGGGGGTTGG + Intergenic
1084490888 11:69477707-69477729 CCCTGCAGGGTGCAGGGTGCTGG - Intergenic
1084693435 11:70739998-70740020 CCCTGCCGGGCCCCTGGTCTGGG - Intronic
1085474819 11:76783256-76783278 CCCTGCCGGGCGCCGGGTGGCGG - Intronic
1087138151 11:94740634-94740656 CCCGGCCGGGCGCTGGGCCGCGG - Intronic
1089197315 11:116701801-116701823 CTCTGCTGGGGGCCGGGTTGGGG - Intergenic
1090029512 11:123195135-123195157 CCCGTCCGGGCGCCAGCTGGTGG - Exonic
1090939056 11:131371880-131371902 CCCAGCAGGGCTCCGGGAGGAGG + Intronic
1092541295 12:9421052-9421074 CCCTGCCGGGGGCAGGGATGTGG - Intergenic
1094497660 12:30998581-30998603 TCCTGCCGGGCACCTGGTGGGGG + Intergenic
1095672540 12:44876907-44876929 CCCTGCCGGGGGCGGGGCGCTGG + Exonic
1095946755 12:47758205-47758227 CCCTGCCAGGAGCTGGGGGGAGG + Intronic
1101867157 12:108528670-108528692 CCGTGCCTGGCCCCGGGTGTGGG + Intronic
1102657244 12:114492309-114492331 CACTGCTTGGAGCCGGGTGGTGG - Intergenic
1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG + Intronic
1103800501 12:123534154-123534176 CCCTCCCGGCGGCCGGGTGGTGG - Intergenic
1105071416 12:133236142-133236164 CTCTGCGGGGCGCGGGGTGCGGG + Intergenic
1110887255 13:80655162-80655184 CCCCGCCGGGCTGCGGGAGGAGG - Intergenic
1113725032 13:112592334-112592356 GGCTGCCAGGTGCCGGGTGGTGG + Intergenic
1115167768 14:30468722-30468744 GGCTGCCTGGAGCCGGGTGGGGG + Intergenic
1115235591 14:31206925-31206947 CTCGGCCGGGCCCCGGGTGTGGG - Intronic
1117097624 14:52314360-52314382 TCCCGCCGCGCGCCGAGTGGCGG - Intronic
1119003902 14:70907520-70907542 CGCTGGCGGGCCGCGGGTGGCGG + Exonic
1119731917 14:76956538-76956560 CCCTGCAGGAAGCCGGCTGGCGG + Intergenic
1120905684 14:89619166-89619188 CCCGGGCGGGCGCCGGGCGCAGG - Intergenic
1121696564 14:95917971-95917993 TCCTGCCAGGGGCTGGGTGGAGG - Intergenic
1121916164 14:97838532-97838554 CCCTCCCGGGGGCCTGGGGGTGG - Intergenic
1122293491 14:100692334-100692356 CCCTGCCCGGCGCCGGGCTGGGG + Intergenic
1122599098 14:102912462-102912484 CCCTGCCGTGCCCTGGCTGGTGG + Intergenic
1122719957 14:103716230-103716252 CCAGGGCGGGCGCCGGGAGGCGG + Intronic
1122982158 14:105196781-105196803 CCGCGCCGGGCGCCGCGGGGAGG - Intergenic
1123625581 15:22224859-22224881 CCTTGACGGGGGCGGGGTGGGGG - Intergenic
1123937582 15:25201492-25201514 CCCTGCAGGGCACCTCGTGGGGG + Intergenic
1124551235 15:30682993-30683015 TCCTCCCGGGCCCCGGGTGGTGG + Intronic
1126793865 15:52244119-52244141 CCCTGCAGGGCCCTGGGTGTCGG + Intronic
1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG + Intronic
1128315107 15:66655121-66655143 CCGGGCCGGGAGCCGGGTGGGGG - Intronic
1128374430 15:67065436-67065458 GCGTGCTGGGCGCGGGGTGGTGG + Intronic
1129208020 15:74048601-74048623 CGTTGCCAGGCACCGGGTGGCGG - Intergenic
1130370600 15:83283428-83283450 CCGTGCTGGGAGCCGGGCGGCGG - Intronic
1131049058 15:89334527-89334549 CTCTGCCGGGCGCAGGCGGGCGG - Intronic
1131515792 15:93075727-93075749 CCCTGCCGGGAGACGGGTACTGG + Intronic
1132889308 16:2196255-2196277 CCCCGCCCGGCGCCGGGTGGGGG + Intronic
1132947122 16:2537937-2537959 TCCTGCCCGGCGCCGCGCGGGGG + Intergenic
1132973725 16:2701358-2701380 CCCTGCGGGGTGCTGGGAGGTGG + Intronic
1133221242 16:4320000-4320022 CCCTGCTGGGGGATGGGTGGGGG + Intronic
1133235486 16:4385582-4385604 CCATGCTTGGCGCAGGGTGGAGG - Intronic
1133235695 16:4386439-4386461 CCCTGCAGGGCCCCCAGTGGAGG - Intronic
1133464919 16:6019757-6019779 CCCTGGCGGCCACTGGGTGGGGG - Intronic
1136003572 16:27313865-27313887 ATCTGCCGGGCGCCGGGGCGGGG + Intronic
1136779002 16:32885606-32885628 GCCGGCCGGGGGCCGGGGGGCGG + Intergenic
1136891616 16:33975912-33975934 GCCGGCCGGGGGCCGGGGGGCGG - Intergenic
1136993701 16:35173427-35173449 CCATGCCGGGTGCCCGGCGGGGG - Intergenic
1137507302 16:49065413-49065435 CCCTGGCAGGCCCCGGCTGGTGG - Intergenic
1137729809 16:50681101-50681123 CCCTGCCTGGCACCTGCTGGGGG - Intronic
1141615507 16:85207419-85207441 CCGTGCCGGCCCCCGGGTGATGG + Intergenic
1141694866 16:85614427-85614449 CCCTCCCCAGCGCCGGGTGGGGG + Intronic
1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG + Intergenic
1142304992 16:89279936-89279958 CTCTGCAGGGAGCCGGGTGGAGG + Exonic
1203081413 16_KI270728v1_random:1147695-1147717 GCCGGCCGGGGGCCGGGGGGCGG + Intergenic
1142597017 17:1034846-1034868 CCCTCCCTGCCGCCGGGTGTGGG + Intronic
1142622431 17:1173397-1173419 CCCTGCCAGGCCCTTGGTGGTGG - Intronic
1142631493 17:1229177-1229199 CCGTGCCGGGAGCCGCCTGGGGG + Intergenic
1142697697 17:1643069-1643091 CGCGGCGGGGCGCCGGGAGGAGG - Intronic
1143272955 17:5689148-5689170 CCCTGCTGGGTGCCCAGTGGAGG + Intergenic
1144066435 17:11628529-11628551 CCCTGCCGCCAGCCAGGTGGCGG - Intronic
1145190834 17:20841574-20841596 CCAGGCCGGGGGCCGGGGGGCGG + Intronic
1145196510 17:20898913-20898935 CCCTGCGGGGGGCGGGGGGGAGG + Intergenic
1146701175 17:34961580-34961602 CCCTGCCGGAGTCCGGGCGGAGG - Exonic
1147315347 17:39617773-39617795 CCGTGCCAGGCGCGGGGCGGGGG - Intergenic
1148095684 17:45051500-45051522 GCCAGCCGGGCGCCGGGGAGGGG - Intronic
1148229020 17:45919568-45919590 CACTGCTGGGCGCAGAGTGGAGG + Intronic
1148566440 17:48635678-48635700 CCCTACCGGGCACCTGGTGGGGG + Intergenic
1150280559 17:63927712-63927734 CCCAGCCTGGCCCAGGGTGGTGG + Intergenic
1150315100 17:64162676-64162698 CCCTGCCAGGAGCTGGGAGGTGG + Intronic
1151297073 17:73193398-73193420 GCCTGCGGGTCGCAGGGTGGGGG - Intronic
1151565095 17:74893305-74893327 CCCGGCCGGGCTGCGGGTGGGGG - Intronic
1151876138 17:76869126-76869148 CCCAGGGGGGCGCCGGGTGGAGG + Intronic
1152007693 17:77692901-77692923 CCCTGTTGGGCATCGGGTGGCGG - Intergenic
1152037057 17:77880070-77880092 CGCTGCCGGGCGGCAGGAGGCGG + Intergenic
1152209889 17:78997418-78997440 GCCTGCCGGGGGCCGGGCGGTGG + Exonic
1152563396 17:81089687-81089709 CCCTGCCGGGCTCCGGGGTCTGG - Intronic
1152587980 17:81197558-81197580 TCCTGCTGGGGGCCGGGTGGGGG + Intronic
1152651795 17:81498138-81498160 GGCTGCCGGGGGCTGGGTGGAGG + Intergenic
1152695201 17:81740806-81740828 CCCTGCTGGGCATGGGGTGGTGG - Intergenic
1152862686 17:82705058-82705080 CCCTGCCTGGCTCCGAGGGGTGG - Intergenic
1153051467 18:906211-906233 CCCTGCCTGGCCCGGGATGGAGG + Intronic
1154329266 18:13416027-13416049 CCCTGCAGGGCGCAGGGCTGAGG + Intronic
1156098641 18:33566345-33566367 CCCAGCTGGGAGGCGGGTGGGGG + Intergenic
1160201821 18:76802189-76802211 CCCGGCCGGGCGCCAGGTGGCGG + Intronic
1160416304 18:78713911-78713933 CCATGTCCGGCGCAGGGTGGTGG - Intergenic
1160419588 18:78735033-78735055 CTCTGCCGGGCACCTGGGGGAGG + Intergenic
1160792036 19:927461-927483 CCTTCCGGGTCGCCGGGTGGGGG - Intronic
1160824645 19:1074020-1074042 GCCTGCCTGCCGCTGGGTGGGGG - Intronic
1160930771 19:1568486-1568508 CCCGCCCGAGCGCCGGGCGGAGG - Intergenic
1160968739 19:1758064-1758086 TCCTGCCGGGCGCCGGGGCCAGG + Intronic
1161018706 19:1997502-1997524 CCCTCCCGGCCGTGGGGTGGCGG - Intronic
1161215817 19:3094592-3094614 CCGGGCCGGGGGCCGGGGGGCGG + Exonic
1161242189 19:3228626-3228648 CCCGGCGGGGGCCCGGGTGGGGG + Intronic
1161273596 19:3403848-3403870 CAATGTCGGGCACCGGGTGGGGG - Intronic
1161409459 19:4108808-4108830 GCCTGCCGGGCGCGAGGAGGAGG + Intronic
1161435063 19:4258221-4258243 ACCTGGCGGGCGCGGGGCGGCGG - Exonic
1161719682 19:5895926-5895948 CCCTGCAGGGCTCCAGGTGCAGG + Intronic
1161852784 19:6746236-6746258 GCCTGCCCAGCGGCGGGTGGCGG + Intronic
1162070307 19:8148931-8148953 CCCTGCCTCGGGTCGGGTGGGGG + Intronic
1162140178 19:8580733-8580755 CCCTGCAGGGCCCTGGCTGGGGG - Exonic
1162909891 19:13842966-13842988 CCCTGCCCGGCCCGGGGAGGGGG - Intergenic
1162948484 19:14057383-14057405 CCGCGCCGCGCGCCGGGAGGTGG - Exonic
1163807011 19:19405683-19405705 CCCAGCCGGGCGCGGGCGGGCGG + Intronic
1164615654 19:29665525-29665547 CCCGGCCGGGCTGCGGGTCGCGG + Intronic
1164658520 19:29942255-29942277 CCCAGCCAGGCGTCGCGTGGCGG - Exonic
1164713305 19:30374796-30374818 TCCGCCCGGGCGCCGGCTGGGGG - Intronic
1164835123 19:31350907-31350929 CGCTGCCGGGCGGCGGCTGCTGG + Intergenic
1165725574 19:38110393-38110415 CGCTGCTGGGGGCCGGGTGTGGG - Intronic
1166564372 19:43754699-43754721 CCGTGACGGGAGTCGGGTGGGGG + Exonic
1166749534 19:45158423-45158445 CACTGCCTGGCGCAGGATGGAGG + Intronic
1166776394 19:45315483-45315505 CCGTGGCGAGCGCCGGGCGGTGG - Exonic
1168079373 19:53998330-53998352 CCCTGCTGGGTGACAGGTGGGGG + Intronic
925329348 2:3046646-3046668 CCCTGCTCAGCGCCTGGTGGGGG + Intergenic
926702129 2:15810780-15810802 CTCTGCCGGGCCCTGTGTGGAGG - Intergenic
927639032 2:24835162-24835184 CCCTGCAGAGCTCTGGGTGGGGG - Intronic
929044339 2:37775571-37775593 CTCAGCCTGGCGGCGGGTGGGGG - Intergenic
929911241 2:46091119-46091141 CCCTGCTGGACACGGGGTGGGGG + Intronic
930688076 2:54330551-54330573 ACCTGCCGGGCTCCGGAGGGCGG + Intronic
931602534 2:64019033-64019055 CCCGGCCGGGCGCCGGGCGGCGG - Exonic
935622816 2:105144072-105144094 AGCTGCCGGGGGCCGGGAGGAGG - Intergenic
935789995 2:106582200-106582222 CCCTGCCATGCGTGGGGTGGAGG - Intergenic
936976190 2:118224541-118224563 CCCCGCCGGGCGCCAGGTTTTGG + Intergenic
937221499 2:120345295-120345317 CCCGGCCGGGCGCGGGGCGCCGG - Intergenic
937283539 2:120736227-120736249 GCCTCTCGGGCGCCGGGCGGTGG - Intronic
938073470 2:128319994-128320016 CCCTGCCGGGGACGGGGTGGGGG + Intergenic
942241103 2:173964670-173964692 CGCCGCCGGGGGGCGGGTGGGGG - Intronic
942277331 2:174332872-174332894 CCCTGAGGGACGCTGGGTGGAGG - Intergenic
942965973 2:181892287-181892309 CCCGGCCGGGCTCCGGGGGGAGG + Intronic
944221880 2:197310992-197311014 CCCGGCCGGGCGCCGCGTGCAGG - Intronic
945245249 2:207711704-207711726 CCCTGCCCGGGGCCGGGCCGCGG + Intronic
945929855 2:215843889-215843911 CCCTGCCTGGGGCCAGGAGGAGG - Intergenic
947668881 2:231924622-231924644 CCCTGCCGGGTGCCGCGTGGTGG - Intronic
948046786 2:234951737-234951759 CCCTGGCCGGCTCCGGGCGGAGG + Intergenic
948468544 2:238163619-238163641 GCCTGCCGGGCGCAGGGGTGGGG - Intronic
948851665 2:240711329-240711351 GCCTGGCGGGCTCCAGGTGGTGG + Intergenic
1169940607 20:10933302-10933324 GCCTGCCAGGGGCGGGGTGGGGG + Intergenic
1171427574 20:25058226-25058248 CCCGGGCGGGCTCCGGGAGGGGG - Intronic
1172799214 20:37564539-37564561 TCCTCCCAGGCGCCGGGAGGCGG - Intergenic
1173820117 20:46014116-46014138 CCCTGCAGGGCGCCAGGTGTGGG + Exonic
1174147159 20:48460017-48460039 TCCTGCAGTGAGCCGGGTGGGGG + Intergenic
1176168383 20:63686216-63686238 CCCGGCCAGGCGCTGCGTGGAGG - Intronic
1176285563 21:5017439-5017461 CCCTGCAGGGCAGGGGGTGGAGG + Intergenic
1176380673 21:6110960-6110982 CGCGGCCGAGCGCCGGGCGGAGG - Intergenic
1176547899 21:8209302-8209324 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
1176555795 21:8253515-8253537 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
1176566832 21:8392335-8392357 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
1176574732 21:8436549-8436571 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
1176611346 21:8987842-8987864 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
1178493616 21:33070075-33070097 ACCTGCGGGGCAGCGGGTGGCGG - Intergenic
1179742799 21:43427280-43427302 CGCGGCCGAGCGCCGGGCGGAGG + Intergenic
1179871618 21:44246036-44246058 CCCTGCAGGGCAGGGGGTGGAGG - Intergenic
1181078058 22:20394445-20394467 CTCAGCCGGGCGCGGGGAGGGGG + Intronic
1181121444 22:20670389-20670411 CCAAGCCGGGGGCCGGGGGGCGG - Intergenic
1181305930 22:21917278-21917300 CACTGCCGGGAGCCGGGGGAGGG + Intergenic
1181334403 22:22117413-22117435 CCAAGCCGGGGGCCGGGGGGCGG - Intergenic
1182804344 22:33057962-33057984 CCGGGCCGGGCGCTGGGTGGAGG + Intronic
1183228285 22:36564885-36564907 ACCTGCGGGGCGCAGGGTGGCGG + Exonic
1183328509 22:37207080-37207102 CTCAGCTGGGCGCCGGGTGTGGG - Exonic
1183383342 22:37501460-37501482 CACTGCCGGGGGCCAGGTGGGGG + Intronic
1183504918 22:38203432-38203454 CCCTGCCTGGCCCAGGGTGAGGG - Intronic
1183586352 22:38755459-38755481 CGCTGCCCGGGGCCGGGTTGGGG + Intronic
1184184271 22:42853910-42853932 CCCTTCCGGGCGTGGGATGGTGG + Intronic
1184554760 22:45227123-45227145 ACCTGCCGTGGGCCGGGTGCTGG - Intronic
1184986797 22:48141366-48141388 CCGTGCCTGGTGCAGGGTGGAGG - Intergenic
1185055369 22:48576155-48576177 GGCTGCGGGGCGCCGGGGGGCGG - Intronic
1185313666 22:50170012-50170034 CCCTGCGGGGCTCCGGGCTGGGG - Intergenic
1203252780 22_KI270733v1_random:125600-125622 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
1203260836 22_KI270733v1_random:170686-170708 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
950443577 3:13023470-13023492 CCCTGCTGGGTGCCAGGTGCTGG - Intronic
950586361 3:13895299-13895321 CCCCGCCGGGCTCGGGTTGGGGG - Intergenic
953246432 3:41198890-41198912 CCCGGCCGGGCGCGGGTTAGGGG - Intronic
954401690 3:50322569-50322591 CCCTCCCGGGCGCCAGGAGAGGG + Exonic
954809879 3:53241244-53241266 CCCTGCCGGGAGATGGATGGTGG + Exonic
959530793 3:107431709-107431731 CCCCGCCGCGCGCGGGGTTGCGG - Intergenic
961178029 3:124852126-124852148 CTCTGCCGGGCAGCGGGAGGTGG - Intronic
961539436 3:127590073-127590095 CCCGGTCCGGCGCGGGGTGGCGG - Intronic
963939753 3:151086515-151086537 CCCAGCTGGGCGCAGGATGGGGG - Intronic
966596308 3:181727171-181727193 CACTGGCGGGGGCGGGGTGGGGG - Intergenic
968293436 3:197555834-197555856 ACCTGCGCGGCGCCGGGTGAAGG - Exonic
968662384 4:1804089-1804111 GTCTCCCGGGCGCCTGGTGGCGG + Intronic
968701771 4:2060886-2060908 CCCGGCCGCGCTCCTGGTGGAGG - Intronic
968766091 4:2469826-2469848 CGCTTCCGGGCCCCGGCTGGTGG + Intronic
969710420 4:8840180-8840202 GCCTGCCCGGGGCGGGGTGGGGG + Intergenic
971231021 4:24800251-24800273 CCCTGGCCGCCGCCGGGTGGGGG - Exonic
974047277 4:56908363-56908385 CCCCGCCGGGCGGGGGCTGGCGG + Intronic
975409988 4:74038510-74038532 ACCTGCTGCGCGCCGGCTGGCGG + Exonic
975415376 4:74099019-74099041 ACCTGCTGCGCGCCGGCTGGCGG + Exonic
976265980 4:83186190-83186212 CCCGTCCGGGAGCGGGGTGGGGG - Intergenic
977941948 4:102868916-102868938 ACCTGCCGGGCGCCGATTGGCGG - Intergenic
979134016 4:117085624-117085646 CCGGGCCTGGCGCCGGGTAGGGG - Intergenic
979349646 4:119628908-119628930 CACTGCCGGACCCCGGGTGGGGG - Exonic
984502170 4:180570477-180570499 CCCTGCCAGGGGCTGGGCGGTGG + Intergenic
985670696 5:1205156-1205178 CCCTGCAGGGCGCCTGGACGTGG - Intronic
986480536 5:8182673-8182695 ACCTGCTGGGTGGCGGGTGGGGG - Intergenic
987088186 5:14488170-14488192 CCTTGCCAGGGGCCGCGTGGCGG - Exonic
988796579 5:34657228-34657250 CCCTGCCTGGTGGGGGGTGGGGG + Intronic
989147034 5:38258893-38258915 CCCTGCTGGGCTCCGGGGCGAGG + Intronic
989585844 5:43073317-43073339 GCCTGCAGGGCCCCGGATGGCGG + Intronic
990347466 5:54884190-54884212 CCTTGCCGGGCTCCGGGTCGCGG - Intergenic
992796109 5:80256149-80256171 CCTTCCCGGGCGCCCGGCGGCGG + Intergenic
993733091 5:91445659-91445681 CCCTGCAGGGCGGGGGGGGGGGG - Intergenic
997239171 5:132294354-132294376 CCCGGCCGGGCGCGGGGAAGGGG - Intronic
997297410 5:132776894-132776916 CCTTGCCGGGCGGCTGGTCGGGG - Intronic
998152337 5:139764605-139764627 CACTGCGGGGCGCCGGGGGAGGG - Intergenic
999767995 5:154755455-154755477 GCCTGCCGGGCTCGGGGTGGGGG + Intronic
1002021141 5:176365326-176365348 CCCTGCCAGGTGCAGGGTGGAGG - Intergenic
1002046268 5:176543283-176543305 ACGCGCCGGCCGCCGGGTGGGGG - Intronic
1002059913 5:176620165-176620187 CTGGGCTGGGCGCCGGGTGGGGG - Exonic
1002429083 5:179192642-179192664 CCCTGCCAGGCGCGGGTGGGAGG + Intronic
1002581420 5:180211477-180211499 CCCTGCTGGGAGCAGGGTAGGGG + Intergenic
1002778507 6:348872-348894 CCCAGCCCGGCGCCAGGCGGTGG + Exonic
1002888234 6:1313637-1313659 CCCTGCAGGGCGCCGCGGGGAGG - Exonic
1004561969 6:16760568-16760590 CGCGGCCGGGTGCCGGGCGGGGG - Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1011195468 6:84774858-84774880 CGCCGCCGGGCACCGGGCGGGGG + Intergenic
1015315128 6:131808288-131808310 CCCTCCCGGGCGCCGGGGCCTGG - Intronic
1018872259 6:167792192-167792214 TCCTGGCGGGTGCGGGGTGGCGG + Intronic
1019317046 7:391649-391671 CCCTGCAGGGCCCCAGATGGAGG + Intergenic
1019531594 7:1506222-1506244 CCCTGCCGGACGCCAGGCGGGGG + Intergenic
1022363443 7:29685319-29685341 CCCCTCGGGGCGCCGGGCGGCGG - Intergenic
1024598945 7:50962954-50962976 CCCTGCAGGAAGCCTGGTGGTGG + Intergenic
1027390181 7:77696419-77696441 CCCTGCCCCGCGCCGGCTAGCGG + Intergenic
1029270458 7:99374397-99374419 GACTGCCGGGCGCAGGGTCGGGG - Intronic
1031940998 7:127789140-127789162 CACTGCTGGGGGCAGGGTGGAGG - Intronic
1033253076 7:139777475-139777497 CCCCCTCGGGCCCCGGGTGGGGG + Intronic
1034263665 7:149771856-149771878 CCCTGCCGGGCTCGGGCGGGCGG - Intronic
1034968228 7:155404315-155404337 CCCTGCCTGGTGCCTGGAGGTGG - Intergenic
1034995068 7:155571827-155571849 CCCTGCAGGGCACAGGCTGGTGG + Intergenic
1035388553 7:158490182-158490204 GGCTGCCGGGCGCCGGGGAGCGG + Intronic
1035537967 8:406920-406942 CCCTGAGGCGCGCCGGGAGGCGG + Intronic
1035651504 8:1269253-1269275 CCATGCTGGGTGCCGGGAGGAGG + Intergenic
1036640327 8:10579596-10579618 CCCAGTGGGGGGCCGGGTGGGGG - Intergenic
1037579160 8:20234576-20234598 CCCCGCTGGGCCCTGGGTGGGGG - Intergenic
1039885111 8:41650067-41650089 GCCTGGCGGGTGCCGGGAGGTGG + Intronic
1045571284 8:103371436-103371458 CCACGCCGGGCTCGGGGTGGGGG + Intergenic
1047998471 8:130358246-130358268 CCAGGCCGGGCGGCGGGTGGCGG - Intronic
1049639336 8:143707595-143707617 CCGGGCCGGGGGCGGGGTGGGGG - Intronic
1049672016 8:143874085-143874107 TCCTGCCAGGAGCCGGGTGCAGG + Intronic
1049846900 8:144807254-144807276 GACTGCCGGGCACCGTGTGGGGG + Exonic
1050090696 9:2015163-2015185 CCCGTCCGGGCGCGGGTTGGCGG - Intergenic
1050173221 9:2843978-2844000 CCCTGCCGGGCGCTGGAAGTCGG - Intronic
1050852049 9:10300481-10300503 GCTTGCTGGGCTCCGGGTGGTGG - Intronic
1051265701 9:15306941-15306963 GGCTGGCGGGCGCCGGGTGGGGG - Intronic
1051629364 9:19127715-19127737 GCCTGTCGGGAGCCGGGCGGGGG + Intronic
1053540413 9:38968039-38968061 TGGTGCCGGGCGGCGGGTGGGGG - Intergenic
1053804762 9:41790197-41790219 TGGTGCCGGGCGGCGGGTGGGGG - Intergenic
1054496152 9:65824994-65825016 GCCTGCCGGGGGCGGGGGGGGGG - Intergenic
1054625727 9:67395884-67395906 TGGTGCCGGGCGGCGGGTGGGGG + Intergenic
1057441851 9:95089162-95089184 CTCTGCCAGGCCCTGGGTGGAGG - Intergenic
1060406578 9:123375891-123375913 CCCTTCCTGGGGCGGGGTGGGGG + Intronic
1061327569 9:129873613-129873635 CCCAGAAGGGAGCCGGGTGGAGG + Intronic
1061373231 9:130209611-130209633 CCCAGCCTGGCGCCGTGTTGGGG + Intronic
1062026262 9:134342110-134342132 CTCTGCTGGGCCCGGGGTGGGGG + Intronic
1062397952 9:136360080-136360102 CCCTGACGGGGGCCCCGTGGGGG - Intronic
1062436677 9:136549423-136549445 CCCTGCTGGGTCCTGGGTGGGGG + Intergenic
1062562327 9:137147015-137147037 GCCTGTCGGGCGCTGGGGGGAGG - Intronic
1062568408 9:137173360-137173382 CCCAGCCTGGGGCCAGGTGGTGG + Intergenic
1203768405 EBV:38365-38387 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768455 EBV:38490-38512 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768505 EBV:38615-38637 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768555 EBV:38740-38762 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768605 EBV:38865-38887 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768655 EBV:38990-39012 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768705 EBV:39115-39137 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768755 EBV:39240-39262 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768805 EBV:39365-39387 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768855 EBV:39490-39512 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768905 EBV:39615-39637 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203768955 EBV:39740-39762 CGCTGCCCCGCTCCGGGTGGGGG + Intergenic
1203469183 Un_GL000220v1:108751-108773 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
1203477004 Un_GL000220v1:152723-152745 CCCTCCCGGCCGCCGGGCGCGGG + Intergenic
1190263970 X:48816594-48816616 CGCTGCCTGCCGCCTGGTGGAGG + Exonic
1191907404 X:66108100-66108122 CCATGCCTGGCCCGGGGTGGGGG - Intergenic
1197694898 X:129540305-129540327 CCGCGCCGGGCGCCGGGCGCCGG - Exonic
1200100803 X:153688448-153688470 GCCGGCCGGGGGCCGGGGGGCGG - Exonic