ID: 1085474819

View in Genome Browser
Species Human (GRCh38)
Location 11:76783256-76783278
Sequence CCCTGCCGGGCGCCGGGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 303}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085474819_1085474833 -2 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474833 11:76783277-76783299 GGGGGAGCCTGGCTGCGGGCGGG 0: 1
1: 0
2: 3
3: 59
4: 670
1085474819_1085474832 -3 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474832 11:76783276-76783298 GGGGGGAGCCTGGCTGCGGGCGG 0: 1
1: 0
2: 7
3: 161
4: 1064
1085474819_1085474842 12 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474819_1085474831 -6 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474831 11:76783273-76783295 GCAGGGGGGAGCCTGGCTGCGGG 0: 1
1: 0
2: 4
3: 62
4: 696
1085474819_1085474844 25 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474844 11:76783304-76783326 GGGGGGCGGGCCGCGCCGCGCGG 0: 1
1: 0
2: 7
3: 108
4: 750
1085474819_1085474837 5 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474837 11:76783284-76783306 CCTGGCTGCGGGCGGGGACCGGG 0: 1
1: 1
2: 3
3: 45
4: 457
1085474819_1085474830 -7 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474830 11:76783272-76783294 GGCAGGGGGGAGCCTGGCTGCGG 0: 1
1: 0
2: 9
3: 99
4: 1048
1085474819_1085474834 -1 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474834 11:76783278-76783300 GGGGAGCCTGGCTGCGGGCGGGG 0: 1
1: 0
2: 3
3: 59
4: 648
1085474819_1085474839 7 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474839 11:76783286-76783308 TGGCTGCGGGCGGGGACCGGGGG 0: 1
1: 0
2: 3
3: 46
4: 389
1085474819_1085474835 4 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474835 11:76783283-76783305 GCCTGGCTGCGGGCGGGGACCGG 0: 1
1: 0
2: 6
3: 52
4: 498
1085474819_1085474838 6 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474838 11:76783285-76783307 CTGGCTGCGGGCGGGGACCGGGG 0: 1
1: 0
2: 5
3: 43
4: 437
1085474819_1085474841 11 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474841 11:76783290-76783312 TGCGGGCGGGGACCGGGGGGCGG 0: 1
1: 0
2: 8
3: 117
4: 1162
1085474819_1085474840 8 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474840 11:76783287-76783309 GGCTGCGGGCGGGGACCGGGGGG 0: 1
1: 0
2: 13
3: 101
4: 801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085474819 Original CRISPR CCCTGCCGGGCGCCGGGTGG CGG (reversed) Intronic