ID: 1085474842

View in Genome Browser
Species Human (GRCh38)
Location 11:76783291-76783313
Sequence GCGGGCGGGGACCGGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1644
Summary {0: 1, 1: 1, 2: 17, 3: 208, 4: 1417}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085474823_1085474842 9 Left 1085474823 11:76783259-76783281 CCACCCGGCGCCCGGCAGGGGGG 0: 1
1: 0
2: 0
3: 25
4: 228
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474829_1085474842 -2 Left 1085474829 11:76783270-76783292 CCGGCAGGGGGGAGCCTGGCTGC 0: 1
1: 0
2: 3
3: 50
4: 387
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474811_1085474842 29 Left 1085474811 11:76783239-76783261 CCCGCGGCCGGCCCGAGCCGCCA 0: 1
1: 0
2: 3
3: 12
4: 186
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474815_1085474842 18 Left 1085474815 11:76783250-76783272 CCCGAGCCGCCACCCGGCGCCCG 0: 1
1: 0
2: 4
3: 39
4: 301
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474826_1085474842 5 Left 1085474826 11:76783263-76783285 CCGGCGCCCGGCAGGGGGGAGCC 0: 1
1: 0
2: 1
3: 22
4: 259
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474816_1085474842 17 Left 1085474816 11:76783251-76783273 CCGAGCCGCCACCCGGCGCCCGG 0: 1
1: 0
2: 2
3: 20
4: 254
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474810_1085474842 30 Left 1085474810 11:76783238-76783260 CCCCGCGGCCGGCCCGAGCCGCC 0: 1
1: 0
2: 2
3: 40
4: 306
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474825_1085474842 6 Left 1085474825 11:76783262-76783284 CCCGGCGCCCGGCAGGGGGGAGC 0: 1
1: 0
2: 1
3: 26
4: 275
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474814_1085474842 22 Left 1085474814 11:76783246-76783268 CCGGCCCGAGCCGCCACCCGGCG 0: 1
1: 0
2: 0
3: 29
4: 265
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474819_1085474842 12 Left 1085474819 11:76783256-76783278 CCGCCACCCGGCGCCCGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 303
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474828_1085474842 -1 Left 1085474828 11:76783269-76783291 CCCGGCAGGGGGGAGCCTGGCTG 0: 1
1: 0
2: 3
3: 53
4: 1088
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417
1085474812_1085474842 28 Left 1085474812 11:76783240-76783262 CCGCGGCCGGCCCGAGCCGCCAC 0: 1
1: 0
2: 0
3: 27
4: 261
Right 1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG 0: 1
1: 1
2: 17
3: 208
4: 1417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085474842 Original CRISPR GCGGGCGGGGACCGGGGGGC GGG Intronic