ID: 1085478107

View in Genome Browser
Species Human (GRCh38)
Location 11:76800350-76800372
Sequence GTACGGTGCCTGGCACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085478101_1085478107 30 Left 1085478101 11:76800297-76800319 CCCTCCACAGGACTGTGTGTAGA No data
Right 1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG No data
1085478102_1085478107 29 Left 1085478102 11:76800298-76800320 CCTCCACAGGACTGTGTGTAGAA No data
Right 1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG No data
1085478103_1085478107 26 Left 1085478103 11:76800301-76800323 CCACAGGACTGTGTGTAGAAGAA No data
Right 1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085478107 Original CRISPR GTACGGTGCCTGGCACAAAA TGG Intergenic
No off target data available for this crispr