ID: 1085480866

View in Genome Browser
Species Human (GRCh38)
Location 11:76821569-76821591
Sequence TCTCAGATGGGGCAGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085480866_1085480877 16 Left 1085480866 11:76821569-76821591 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 1085480877 11:76821608-76821630 GCCCGGCAGCCACCCCATCTGGG 0: 236
1: 870
2: 3957
3: 4312
4: 3171
1085480866_1085480872 -1 Left 1085480866 11:76821569-76821591 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 1085480872 11:76821591-76821613 AAGTGAGGAGCCCCTCTGCCCGG 0: 3609
1: 5018
2: 8026
3: 8507
4: 2309
1085480866_1085480876 15 Left 1085480866 11:76821569-76821591 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 1085480876 11:76821607-76821629 TGCCCGGCAGCCACCCCATCTGG 0: 30
1: 618
2: 2881
3: 3617
4: 2512
1085480866_1085480880 24 Left 1085480866 11:76821569-76821591 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 1085480880 11:76821616-76821638 GCCACCCCATCTGGGAAGTGAGG 0: 532
1: 2666
2: 5168
3: 10303
4: 6855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085480866 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG (reversed) Intergenic
Too many off-targets to display for this crispr