ID: 1085482468

View in Genome Browser
Species Human (GRCh38)
Location 11:76834127-76834149
Sequence TCCCCTCAGCCTAGGTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085482465_1085482468 9 Left 1085482465 11:76834095-76834117 CCCTCTGATAAAAAGTTTGTTTG No data
Right 1085482468 11:76834127-76834149 TCCCCTCAGCCTAGGTTCACTGG No data
1085482466_1085482468 8 Left 1085482466 11:76834096-76834118 CCTCTGATAAAAAGTTTGTTTGT No data
Right 1085482468 11:76834127-76834149 TCCCCTCAGCCTAGGTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085482468 Original CRISPR TCCCCTCAGCCTAGGTTCAC TGG Intergenic
No off target data available for this crispr