ID: 1085486364

View in Genome Browser
Species Human (GRCh38)
Location 11:76866887-76866909
Sequence CTACATAAAGGGAAATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085486364 Original CRISPR CTACATAAAGGGAAATGGAG GGG Intronic
901669086 1:10843913-10843935 CTATCTAAAGTGAAATGCAGAGG - Intergenic
902563128 1:17290622-17290644 CTTTATAAAGGGACGTGGAGTGG + Intergenic
902694802 1:18133131-18133153 CTCCATAAAGGAAGAGGGAGGGG + Intronic
903471879 1:23593027-23593049 CTACCTTAAGGGCAGTGGAGAGG + Intronic
904282358 1:29429492-29429514 CAACATGAAGCCAAATGGAGAGG - Intergenic
906874399 1:49521102-49521124 CTACATAAAGTGAATGGGTGAGG - Intronic
907677540 1:56532459-56532481 GTAGATAAAGGGAGATGGAGGGG + Intronic
908024583 1:59937148-59937170 CTCCATCATAGGAAATGGAGAGG - Intergenic
908640436 1:66217089-66217111 GTACAAGAAGGGAAATGGAGTGG + Intronic
909130837 1:71734918-71734940 GTAATTAAATGGAAATGGAGGGG - Intronic
910294972 1:85635451-85635473 CCTCATAAATGGAAATGGAGTGG - Intergenic
910350361 1:86289481-86289503 ATTCATAAAGGGAAAAGGATTGG + Intergenic
910972019 1:92865563-92865585 CTCCAAGAAGGGAAATGGAGTGG - Intronic
912847325 1:113086573-113086595 CTACAGCAACAGAAATGGAGGGG - Intronic
913509698 1:119550537-119550559 CTACAAGCAGGGAAATGGAAAGG + Intergenic
913961914 1:143346149-143346171 CTCAATAAATGGTAATGGAGAGG + Intergenic
913964260 1:143362159-143362181 GTAAATAAATGGAAAAGGAGAGG - Intergenic
914056269 1:144171723-144171745 CTCAATAAATGGTAATGGAGAGG + Intergenic
914122877 1:144794639-144794661 CTCAATAAATGGTAATGGAGAGG - Intergenic
915282781 1:154833908-154833930 ATAAATAAAGGGAAATGGTCTGG + Intronic
916384551 1:164252770-164252792 ATCAATAAAGGGAAATAGAGAGG + Intergenic
916486377 1:165263369-165263391 ATCCATCAATGGAAATGGAGAGG - Intronic
916551998 1:165858605-165858627 CTACAGAAAGGGCTATGAAGTGG - Intronic
916769319 1:167892708-167892730 CTTCATAGAGTGAATTGGAGAGG - Intronic
918107068 1:181424635-181424657 CTTCAGAAAGAGAAAGGGAGTGG - Intronic
918616962 1:186555815-186555837 CTATATAGAGTGAAAAGGAGAGG - Intergenic
920015955 1:202908626-202908648 CCACATAAGGGGAAGTGAAGAGG + Intronic
920694277 1:208170060-208170082 CTGCATATGGGGAAATGAAGGGG - Intronic
922476545 1:225910782-225910804 TTAAATTAAGGGAAATAGAGAGG - Intronic
922620385 1:226984932-226984954 CTACATTCAGGTAACTGGAGAGG + Exonic
922716829 1:227880858-227880880 CAAAATAAATGGAAATGGAGGGG + Intergenic
923045141 1:230350274-230350296 GTACACAAAGGGAGATGGTGGGG - Intronic
923959663 1:239063548-239063570 TAACATAAAGGAAACTGGAGAGG + Intergenic
924341605 1:243040436-243040458 CTCCAAAAAAAGAAATGGAGAGG + Intergenic
1063089145 10:2846140-2846162 CTAGAAACACGGAAATGGAGTGG - Intergenic
1063464285 10:6232959-6232981 CTGCAGAAATGGAAATGGAATGG - Exonic
1063758871 10:9048481-9048503 CTACCAAAAGGGAAATGTGGAGG - Intergenic
1065881709 10:30042781-30042803 CTACCTGAAAGGAAAGGGAGGGG - Intronic
1066475578 10:35744638-35744660 CTTCATAAAGAGAAAAGGAAGGG - Intergenic
1068911663 10:62384639-62384661 ATACATAGTAGGAAATGGAGGGG + Intronic
1072141669 10:92594033-92594055 CGAGATAAAGGGATGTGGAGGGG + Intronic
1072236279 10:93456741-93456763 GAACACAAAGGGAAACGGAGTGG + Intronic
1074516991 10:114179453-114179475 CTGCATGAAGGGGAAGGGAGGGG + Intronic
1074704824 10:116121346-116121368 CTACAGAAAAGCAAATGCAGAGG - Intronic
1074846961 10:117406899-117406921 CTACATGAGGAGGAATGGAGGGG + Intergenic
1077808194 11:5610442-5610464 CTACATTGAGGGGAATGGTGAGG - Intronic
1078323734 11:10360808-10360830 CTACATAAAGGAAAGCAGAGTGG + Intronic
1079479958 11:20869266-20869288 CTATATAAAGGGAGGAGGAGAGG + Intronic
1080639538 11:34150657-34150679 CCACATAAAGGGCCGTGGAGGGG + Intergenic
1080689566 11:34545113-34545135 GTGCCTAAAGGGAAATTGAGGGG + Intergenic
1081289897 11:41311852-41311874 CACAATACAGGGAAATGGAGGGG - Intronic
1081978887 11:47254027-47254049 CTACAAAGAGGGAAAAGGAGAGG - Intronic
1082772227 11:57216970-57216992 TTACATAAAGCTAAATGGAGCGG + Intergenic
1083153119 11:60805996-60806018 TACCATAAAGGGAAATTGAGAGG + Intergenic
1084484953 11:69442914-69442936 CTACTTAACAGGAAATGCAGCGG + Intergenic
1085186496 11:74580192-74580214 TTAAATACATGGAAATGGAGAGG - Intronic
1085486364 11:76866887-76866909 CTACATAAAGGGAAATGGAGGGG + Intronic
1085840515 11:80006460-80006482 TTAGATAAATGGAAATGGACAGG + Intergenic
1086037168 11:82430802-82430824 ATAAATCAAGGGGAATGGAGAGG - Intergenic
1086671758 11:89556514-89556536 CTCCATCAAGGGGAAGGGAGGGG + Intergenic
1087720201 11:101655685-101655707 CTAAATAAAGGGAGATGGAGGGG - Intronic
1090552972 11:127842712-127842734 ATACAGAAATGGAAATGGAAAGG + Intergenic
1090738775 11:129637321-129637343 GTAACTAAAGGAAAATGGAGTGG - Intergenic
1092181159 12:6447911-6447933 CCGCCAAAAGGGAAATGGAGGGG - Intronic
1094762826 12:33554428-33554450 GCACATAGAGGGGAATGGAGGGG - Intergenic
1095275948 12:40282399-40282421 CTACATTAAATGAAATGGATGGG + Intronic
1096231981 12:49901892-49901914 CAACAGAAAGGGAAGAGGAGAGG + Intronic
1097307117 12:58081548-58081570 CTACCTAACTGCAAATGGAGTGG + Intergenic
1098946772 12:76598680-76598702 CAGCATGAAGGGAAATGAAGAGG + Intergenic
1099228468 12:79996178-79996200 CTACATACATGGAAAGGGAGAGG - Intergenic
1102313670 12:111867805-111867827 TTACAAAAAGGGAGATGGAGGGG - Intronic
1103189168 12:118986084-118986106 CTGCATAAAGGGAAATTGTAAGG + Intronic
1103251057 12:119500384-119500406 CTACATAATGGGGACAGGAGGGG + Intronic
1103877322 12:124138468-124138490 ATACATTAAGGGAAATGTGGGGG - Intronic
1104377789 12:128280097-128280119 CTACATACATGAAAATGGGGAGG + Intronic
1106116010 13:26818203-26818225 CTGCAGAAAGGGAAGTGGATAGG - Intergenic
1106735538 13:32585374-32585396 CCACAAAAATGGAAATGAAGAGG + Intergenic
1107189367 13:37560848-37560870 CTACATAAGGAGAAATGAGGAGG + Intergenic
1107458531 13:40578125-40578147 CTAAAGAAAGGGCAGTGGAGCGG + Intronic
1107863247 13:44681239-44681261 CCACATAAAAGAGAATGGAGAGG - Intergenic
1109048176 13:57439994-57440016 ATACATAAAGTAAAATGGAGTGG + Intergenic
1110393853 13:75007389-75007411 GAACATAAATGGAAATGAAGAGG - Intergenic
1111705259 13:91740561-91740583 CTATATAAACAGAAATGGATTGG - Intronic
1114728725 14:24967442-24967464 TTACATGAAGTGAAAAGGAGAGG - Intronic
1115708826 14:36027628-36027650 CTACATAAGGGGAAAAGCAGGGG - Intergenic
1115927825 14:38456772-38456794 CTGCATAAAGAGATAAGGAGGGG - Intergenic
1116693846 14:48147186-48147208 GTACACAAAGGGATATAGAGTGG + Intergenic
1116942420 14:50803759-50803781 TTCCATAAAGGGAGAGGGAGAGG + Intronic
1117699429 14:58397981-58398003 CTGAGTAAAGGGTAATGGAGAGG + Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124733397 15:32220319-32220341 ATACATAAAAGGAAATGAGGTGG - Intergenic
1126457892 15:48884472-48884494 TTACATAAAGTAAAATAGAGAGG - Intronic
1127330222 15:57931768-57931790 CAACATGAGGGGAAGTGGAGGGG - Intergenic
1127658811 15:61080897-61080919 CTACATAAAGAGACAAGGATGGG + Intronic
1127945560 15:63747724-63747746 CTTGATGAAGGGAAAGGGAGTGG + Exonic
1127974160 15:63984802-63984824 CTACATACAGGGAAATGCCTGGG + Intronic
1128144980 15:65328067-65328089 CTACAGAAATAGAAATGGATTGG - Exonic
1128308688 15:66616999-66617021 CCCCAGAAAGGGAAATGGATTGG + Intronic
1129264341 15:74385959-74385981 CTCCATAAAGGAAACCGGAGAGG + Intergenic
1130694855 15:86120861-86120883 GAACTTAAAGGGAAAAGGAGAGG - Intergenic
1133720285 16:8488370-8488392 CTACAGTCAGGGAAATTGAGTGG + Intergenic
1136185106 16:28583396-28583418 CTATATAAATGGGAATGGATTGG - Intronic
1138070926 16:53992284-53992306 CTGCAGAAATGGAAATAGAGTGG + Intronic
1138733487 16:59222905-59222927 CAAAATAAAGGGTAATGGTGGGG + Intergenic
1139469766 16:67171903-67171925 GGACATAAAGGGAGATGGAGGGG + Intronic
1140640144 16:76961979-76962001 CTAAATAAAGGGAAAAGTAGAGG - Intergenic
1140714187 16:77707051-77707073 TTACAAAAAAGGAAATGGATTGG + Intergenic
1142341693 16:89527565-89527587 CTACAGACAGGAAAATGGAACGG + Intronic
1142704539 17:1686170-1686192 TTTCATAAAGGTAAATGGAGAGG + Intergenic
1144139370 17:12333336-12333358 CTTCATAAAGTGAATTAGAGAGG + Intergenic
1144177662 17:12722648-12722670 CCAAATAAAGGCAAATCGAGAGG - Intronic
1144429401 17:15177287-15177309 ATTCATAAAGGGCAATGGTGAGG - Intergenic
1146351583 17:32099821-32099843 ATTCATAAAAGGAAATGAAGGGG - Intergenic
1146895502 17:36538148-36538170 CTACGTAAAGAGATATGAAGAGG - Exonic
1147249106 17:39142497-39142519 CAACCTAGAGGGAACTGGAGAGG - Intronic
1147809625 17:43159253-43159275 TTACATACAGTGAAATGCAGAGG - Intergenic
1148467040 17:47871524-47871546 AGACAAAAAGAGAAATGGAGAGG - Intergenic
1151425012 17:74025334-74025356 TTAGATAAAGGGCAATTGAGGGG - Intergenic
1152248286 17:79197790-79197812 CTGTACAAAGGGGAATGGAGTGG - Intronic
1203212045 17_KI270730v1_random:86752-86774 TTAAATGAAGTGAAATGGAGTGG + Intergenic
1153156890 18:2159897-2159919 CCACATAAAGGGCTATGCAGTGG - Intergenic
1153432717 18:5036622-5036644 GTACATAAAAGGCTATGGAGAGG - Intergenic
1155468905 18:26170041-26170063 TGAGATACAGGGAAATGGAGGGG - Intronic
1155651243 18:28144915-28144937 AAAAATAAAGGGAAATGGGGAGG + Intronic
1156345033 18:36249355-36249377 ATACAAAAGGGGAAATGAAGAGG - Intronic
1158071791 18:53478879-53478901 CTACACAAATGGACATTGAGAGG + Intronic
1159444283 18:68521602-68521624 ATTCATAAAGGGAAGTAGAGAGG + Intergenic
1160315074 18:77835936-77835958 CTACATAAAGGAAAAGAGATTGG + Intergenic
1162343171 19:10104751-10104773 CAACTTAAAGGGAAATGGGGTGG + Intergenic
1162359688 19:10211306-10211328 CCAAAAAAAGGGAAATGAAGTGG - Intronic
1163453551 19:17393078-17393100 CTCCATAAATGGAAATGGCTGGG + Intergenic
1164574233 19:29396346-29396368 CTACAGAAAGGCCAAGGGAGAGG - Intergenic
1164811007 19:31155793-31155815 CAAGTTAGAGGGAAATGGAGGGG - Intergenic
1165751551 19:38263704-38263726 CTCTAGAAAGGGGAATGGAGTGG - Intronic
1167609499 19:50500481-50500503 CTGCAGAAAGGGAGAGGGAGGGG - Intergenic
1202695752 1_KI270712v1_random:124406-124428 CTCAATAAATGGTAATGGAGAGG + Intergenic
1202698031 1_KI270712v1_random:139650-139672 GTAAATAAATGGAAAAGGAGAGG - Intergenic
924990910 2:312342-312364 ATACATAAATGTAAGTGGAGAGG - Intergenic
925436969 2:3846867-3846889 TTAGATAAACTGAAATGGAGTGG + Intronic
927900743 2:26816580-26816602 CTAGATAAAGGAAAAAGGTGAGG - Intergenic
928915434 2:36465255-36465277 CCATATAAAGTGAAAGGGAGAGG - Intronic
930716307 2:54596815-54596837 CTACAGAGAGGCAAATGGAGAGG - Intronic
931561435 2:63566086-63566108 CCAAGTAAAGGGAAATGGATGGG - Intronic
931670991 2:64647056-64647078 CTTCATAAAGGACATTGGAGAGG + Intronic
932036939 2:68254954-68254976 TAACATTAAGAGAAATGGAGAGG + Intronic
932293660 2:70606645-70606667 CTTCATTAAGGTAATTGGAGTGG - Intergenic
932808423 2:74803373-74803395 GTACACAAAGGGAAAGAGAGTGG + Intergenic
933519872 2:83357777-83357799 CTACTTAGAGTGAAATGGAGTGG + Intergenic
933529045 2:83482555-83482577 TTACATAATTGGAAATGAAGGGG + Intergenic
933811589 2:86036052-86036074 CAACAGAAAGGGAACAGGAGGGG + Intronic
934276914 2:91581448-91581470 CTCAATAAATGGTAATGGAGAGG + Intergenic
934279285 2:91597430-91597452 GTAAATAAATGGAAAAGGAGAGG - Intergenic
934759765 2:96847875-96847897 TTACAGAAGAGGAAATGGAGGGG + Intronic
934983637 2:98868810-98868832 ATTCATAAAGAGAAAGGGAGAGG - Intronic
935732417 2:106074925-106074947 CTACATAAAGTGAAATCATGTGG + Intronic
940136213 2:150438433-150438455 CCACAGAAAGGGAGATGGAGAGG - Intergenic
940334911 2:152516099-152516121 CTACAAAAAAGGAAATGGGATGG - Intronic
941168522 2:162109478-162109500 CTAAATAGACTGAAATGGAGAGG + Intergenic
941323034 2:164079536-164079558 CTACATAAATGGAAAGAGTGTGG - Intergenic
941538194 2:166747580-166747602 GTATATAAACAGAAATGGAGTGG + Intergenic
943078442 2:183227377-183227399 ATACATGAAGTGAAATGTAGTGG - Intergenic
943347613 2:186758275-186758297 CTACATAAAAATAAATGGTGAGG + Intronic
943642961 2:190379107-190379129 CTCGCTTAAGGGAAATGGAGTGG + Intergenic
944119631 2:196227101-196227123 CTAAATAAATGGAAATAAAGAGG - Intronic
944261910 2:197687085-197687107 CAACATAAAGAGAAATAGACGGG - Intergenic
945034201 2:205690229-205690251 CTACAGAAAGGAAAATGAGGAGG + Intronic
947332487 2:229044726-229044748 ATACACAAAGCAAAATGGAGGGG - Intronic
948529960 2:238598047-238598069 CTATTTAAAGGGGAATGGAGGGG - Intergenic
1168803796 20:661481-661503 CTACAGAGAGGAAAATGGAGTGG + Intronic
1170314644 20:15029665-15029687 GTACATAAACTGAAATGAAGTGG - Intronic
1173753616 20:45496089-45496111 CTACATAAATGGAATTGGACCGG - Intergenic
1176342556 21:5712397-5712419 CTACACAAAGGGCAATGGAAGGG - Intergenic
1176474810 21:7144548-7144570 CTACACAAAGGGCAATGGAAGGG - Intergenic
1176502271 21:7612059-7612081 CTACACAAAGGGCAATGGAAGGG + Intergenic
1176536877 21:8110466-8110488 CTACACAAAGGGCAATGGAAGGG - Intergenic
1176724060 21:10415206-10415228 GCACATAAAGGGAAAAGGAAAGG - Intergenic
1178919458 21:36729076-36729098 AAAATTAAAGGGAAATGGAGGGG - Intronic
1183857320 22:40643851-40643873 CTCCATGAAGAGAAATAGAGAGG - Intergenic
1203241825 22_KI270733v1_random:26870-26892 CTACACAAAGGGCAATGGAAGGG - Intergenic
949997322 3:9628497-9628519 CTAGGTAAAAGGCAATGGAGAGG + Intergenic
950558447 3:13708676-13708698 CTACATGGAGGGAACTGAAGGGG + Intergenic
951083631 3:18483350-18483372 GTACAAAAAGGGAATTGAAGAGG + Intergenic
951293778 3:20907378-20907400 CTATGTAAAGGGAAATGCATTGG + Intergenic
951630444 3:24714328-24714350 CGACATAATGAGAAATGGAGAGG + Intergenic
952014534 3:28941060-28941082 CTGAATTAAGGAAAATGGAGTGG - Intergenic
952034436 3:29182308-29182330 CTACATAACTGAAAATAGAGGGG - Intergenic
952731571 3:36642205-36642227 CTAGACAAAGGGGACTGGAGGGG + Intergenic
955248266 3:57249939-57249961 TTACATGAAGAAAAATGGAGCGG - Intronic
956075467 3:65500533-65500555 CTACAAAAAGGAAACTGGACTGG + Intronic
956853661 3:73255351-73255373 CTTTATAGAGGGAATTGGAGAGG - Intergenic
959677340 3:109051220-109051242 CAGCAAAAAGAGAAATGGAGAGG - Intronic
960721784 3:120631724-120631746 TTATATAATGGGAAATGGTGAGG + Intronic
963114842 3:141718848-141718870 CTACCCAAAGTGAAATGCAGAGG - Intergenic
963407798 3:144889847-144889869 CCATGTAAAGGGAAATGGATAGG - Intergenic
963701089 3:148627575-148627597 GTACAACAAGGGAGATGGAGGGG + Intergenic
963717329 3:148818793-148818815 CTCCAAAAAGGGAAAGGTAGAGG - Intronic
964698429 3:159536304-159536326 CTACATATAGGGACATGGCATGG - Intronic
965158832 3:165103840-165103862 CAGTATCAAGGGAAATGGAGAGG - Intergenic
965419529 3:168440048-168440070 CTGAATAAAGGGAACTGGGGAGG + Intergenic
966600980 3:181774778-181774800 AAATATAAAGTGAAATGGAGGGG + Intergenic
968990928 4:3911850-3911872 TTAGATAAATGGAAAAGGAGTGG - Intergenic
969031470 4:4218463-4218485 GTAAATAAATGGAAAAGGAGAGG + Intronic
969033849 4:4234935-4234957 CTCAATAAATGGTAATGGAGAGG - Intergenic
969094725 4:4723694-4723716 CCAGAGAGAGGGAAATGGAGTGG - Intergenic
970619470 4:17802593-17802615 CTACACAAAGGAAAATGGCAGGG - Exonic
970619483 4:17802730-17802752 CTACACAAAGGAAAATGGCAGGG - Exonic
970711372 4:18867363-18867385 ATTCATAAAGGCAAATGGTGGGG - Intergenic
971946759 4:33288259-33288281 CTACATGAAAGGAATTAGAGTGG + Intergenic
973159262 4:46994564-46994586 ATACATAAATTAAAATGGAGGGG + Intronic
973580254 4:52337307-52337329 CTATATATAGTGAAATGGAAAGG + Intergenic
974077834 4:57183963-57183985 CAACACAAATGGAAAAGGAGTGG - Intergenic
977129318 4:93214723-93214745 CCACAAAAAGGGAAAAGGGGTGG - Intronic
977201342 4:94120346-94120368 TTTCATAAAGTGAAATGGATTGG + Intergenic
977533241 4:98225043-98225065 TTACATACAGGGAAGTGCAGTGG - Intergenic
978399196 4:108313132-108313154 CTTCATAAAGGGACAGGGAAAGG + Intergenic
985136950 4:186795560-186795582 CTCCATAACTTGAAATGGAGAGG + Intergenic
986661543 5:10064591-10064613 GAACATGAAGGGAAATGGACAGG + Intergenic
987720157 5:21622990-21623012 CCACATAAAGGGCTATGCAGTGG - Intergenic
987820723 5:22962859-22962881 CTACAGAAAGGGAAGAGGACTGG + Intergenic
987941476 5:24544301-24544323 CAACAAAAATGGAAATGGAGAGG + Intronic
988703495 5:33699889-33699911 CTACACAAAGAGAACTGAAGAGG + Intronic
992547914 5:77833155-77833177 CTTCAGTAAGGGAAATGGAAGGG - Intronic
992834685 5:80628405-80628427 TGAGATACAGGGAAATGGAGGGG - Exonic
993568428 5:89505096-89505118 CTACACAAAGGGCTATAGAGTGG + Intergenic
993774809 5:91979737-91979759 CTACAGAAATGCAAATGCAGTGG + Intergenic
993874695 5:93292781-93292803 CTTCATAAAGGTAAAAGGGGAGG - Intergenic
994245149 5:97469611-97469633 CTCCATAAAGGAAAGTGGACTGG + Intergenic
995545245 5:113223639-113223661 TTCGATAAAGGGAAAGGGAGAGG + Intronic
995956514 5:117783261-117783283 ATACATCATGGGAAATGGGGGGG - Intergenic
996899462 5:128527472-128527494 ATACAAAGAGGGAACTGGAGAGG + Intronic
997182621 5:131846342-131846364 CTAAATAAAGGCAAATAGAAGGG + Intronic
998304099 5:141055737-141055759 ATTCATAAAATGAAATGGAGTGG + Intergenic
998736442 5:145146552-145146574 CTGCATAATAGGAAACGGAGAGG + Intergenic
999041193 5:148414768-148414790 CTACATATAGGAGATTGGAGGGG - Intronic
999884804 5:155910301-155910323 CTATTGAAAGGAAAATGGAGAGG + Intronic
1000364172 5:160475771-160475793 ATACATAAAAGGAAAGGGGGTGG + Intergenic
1000560326 5:162779154-162779176 GTAAAGAAAGGGAAATTGAGAGG - Intergenic
1000675740 5:164120339-164120361 GTAGAGAAAGAGAAATGGAGAGG + Intergenic
1001887771 5:175310998-175311020 CTACACAAAGGGAAGGGGAAAGG + Intergenic
1002671263 5:180869565-180869587 CTACAGAAGGGGAAACAGAGAGG + Intergenic
1005128685 6:22477609-22477631 CTACATCAAGGGTATTTGAGAGG - Intergenic
1005562360 6:27053841-27053863 TTACCTATAGGGAAGTGGAGTGG + Intergenic
1005733436 6:28721339-28721361 CTGCAAAAAAAGAAATGGAGTGG + Intergenic
1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG + Intergenic
1006640679 6:35488129-35488151 TTACAAAAAGGGAACTGGTGAGG + Intronic
1009446735 6:63751578-63751600 CTGCTTAAATTGAAATGGAGAGG - Intronic
1010308309 6:74350558-74350580 CTGAAGAAAGGGAGATGGAGAGG + Intergenic
1011452929 6:87514677-87514699 GTACATAAAGTGTCATGGAGTGG + Intronic
1011877291 6:91976782-91976804 ATGCATAAAGGTAAAAGGAGTGG + Intergenic
1012030710 6:94058211-94058233 CTACATATAGGTAAATGGGTAGG - Intergenic
1012886527 6:104852459-104852481 ATACAAAAAGCGAAAAGGAGAGG + Intronic
1013418433 6:109945291-109945313 GGAGAGAAAGGGAAATGGAGGGG - Intergenic
1014014191 6:116510963-116510985 GTACGTAAAGGCATATGGAGTGG + Intronic
1015421703 6:133018022-133018044 CAACACAAAGGAAAAGGGAGAGG + Intergenic
1016096609 6:140045277-140045299 CTAAAAATAGGGAAAGGGAGTGG + Intergenic
1016917824 6:149261256-149261278 CTATATAAAGGAAAATGAAGAGG + Intronic
1022925681 7:35054060-35054082 CCACAAAAAAGGAAATGTAGGGG - Intergenic
1024579590 7:50791396-50791418 CTTCTGAAAGGGAAATGGCGTGG - Intronic
1024881971 7:54096816-54096838 CTAGACAAAGGGAAATGAGGGGG + Intergenic
1025733371 7:64126073-64126095 ATAAATAAAGGGAAAAAGAGTGG - Intronic
1026081100 7:67221625-67221647 CTACACAAAAGGAAATGAAAAGG - Intronic
1026695983 7:72592400-72592422 CTACACAAAAGGAAATGAAAAGG + Intronic
1027379724 7:77594319-77594341 CCAAATAAAAGGAAATGCAGTGG - Intronic
1028730694 7:94145125-94145147 CTACAGAAAGGGAAAAAGAAGGG + Intergenic
1029102609 7:98145237-98145259 TTACAGAAAGGGAAATGAAGAGG + Intronic
1029238173 7:99141085-99141107 CTACTGAAAGGGAAAGGGAAAGG + Intronic
1029823685 7:103168751-103168773 CCACAAAAAAGGAAATGTAGGGG - Intergenic
1029892018 7:103940560-103940582 CCACATAAGGGGATATGGAAAGG - Intronic
1030145984 7:106356336-106356358 CTACATAAACTGCCATGGAGAGG - Intergenic
1030645012 7:112051172-112051194 CAACGTAAAGGGAAATGGAATGG + Intronic
1030698000 7:112607406-112607428 CTCCATAAATGGAGCTGGAGGGG - Intergenic
1034614305 7:152401790-152401812 GCACATAAAGGGAAAAGGAAAGG + Intronic
1036005597 8:4659000-4659022 ATACATAAAGGGAAATGAGAGGG + Intronic
1036101197 8:5787221-5787243 CTAGATACATAGAAATGGAGTGG - Intergenic
1037119859 8:15269939-15269961 CTACAGAAGGGGAAAGAGAGTGG - Intergenic
1039915883 8:41859972-41859994 CTAAAGAAAGGGAAATGGGGAGG + Intronic
1041524930 8:58794787-58794809 GTACACAAAGGCATATGGAGTGG + Intergenic
1042347026 8:67737900-67737922 CTCCATAAAGGTAAAAGGATTGG - Intronic
1047549829 8:125858437-125858459 ATACATCAAGAGAAATGGAAAGG + Intergenic
1047552912 8:125895962-125895984 ATAAATAAAGGGAAATAGAGAGG - Intergenic
1050045694 9:1542508-1542530 GTACACAAAGGCATATGGAGTGG - Intergenic
1051075410 9:13227809-13227831 CTACATAAATGTAAAAGCAGAGG + Intronic
1052232442 9:26170323-26170345 CTACATAAAAGAAAAATGAGAGG + Intergenic
1053044875 9:34907219-34907241 CTACGTTAAGGGAAAGTGAGAGG - Intergenic
1054822525 9:69537739-69537761 TCACAGAAAGGGAAATGCAGTGG - Intronic
1055148832 9:72969828-72969850 CGATATGAAGAGAAATGGAGAGG - Intronic
1057270943 9:93651156-93651178 AGACTAAAAGGGAAATGGAGTGG + Intronic
1057320937 9:94011878-94011900 AAAAATTAAGGGAAATGGAGTGG + Intergenic
1203458146 Un_GL000220v1:9947-9969 CTACACAAAGGACAATGGAAGGG - Intergenic
1186051102 X:5596665-5596687 CTACAAAAAGGCAAAAGTAGGGG + Intergenic
1187160467 X:16759941-16759963 TTAAATAAAAGGAAATGCAGAGG + Intronic
1187567566 X:20467078-20467100 AGACAGAGAGGGAAATGGAGTGG - Intergenic
1188829937 X:34883812-34883834 CTACATACATGGTAATGCAGTGG + Intergenic
1188893936 X:35643542-35643564 TTACATCGAGGGAAATGCAGCGG - Intergenic
1189840813 X:45074601-45074623 CTACATATATGGAAATAAAGGGG - Intronic
1193716755 X:84942990-84943012 CCACATAAAGGGCTATGCAGTGG + Intergenic
1193732314 X:85116077-85116099 CTCTATAAAGTGAAGTGGAGAGG + Intergenic
1194715886 X:97286503-97286525 CCACATTAAGGGAATTGCAGAGG - Intronic
1197783863 X:130181488-130181510 ATATATAAAGGGAAATAGATTGG + Intronic
1199891106 X:152083032-152083054 CTACAAGAAGGGGAAGGGAGGGG + Intergenic
1200089448 X:153627557-153627579 CCACATTAAGGGGAGTGGAGAGG - Intergenic
1201629821 Y:16058721-16058743 TGACATAAAAGGAAATAGAGTGG - Intergenic