ID: 1085486491

View in Genome Browser
Species Human (GRCh38)
Location 11:76868131-76868153
Sequence AGGTTGCTCTTCAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 257}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085486491_1085486500 26 Left 1085486491 11:76868131-76868153 CCATCCTCCCTGAAGAGCAACCT 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1085486500 11:76868180-76868202 CTTTTTTGGTCTTGGGACTCTGG 0: 1
1: 0
2: 0
3: 40
4: 264
1085486491_1085486497 12 Left 1085486491 11:76868131-76868153 CCATCCTCCCTGAAGAGCAACCT 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1085486497 11:76868166-76868188 CACACATCAGGCTTCTTTTTTGG 0: 1
1: 0
2: 2
3: 11
4: 184
1085486491_1085486498 18 Left 1085486491 11:76868131-76868153 CCATCCTCCCTGAAGAGCAACCT 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1085486498 11:76868172-76868194 TCAGGCTTCTTTTTTGGTCTTGG 0: 1
1: 0
2: 0
3: 24
4: 275
1085486491_1085486496 0 Left 1085486491 11:76868131-76868153 CCATCCTCCCTGAAGAGCAACCT 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1085486496 11:76868154-76868176 CAAGTTAGTGAGCACACATCAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1085486491_1085486499 19 Left 1085486491 11:76868131-76868153 CCATCCTCCCTGAAGAGCAACCT 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1085486499 11:76868173-76868195 CAGGCTTCTTTTTTGGTCTTGGG 0: 1
1: 0
2: 2
3: 25
4: 343
1085486491_1085486501 27 Left 1085486491 11:76868131-76868153 CCATCCTCCCTGAAGAGCAACCT 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1085486501 11:76868181-76868203 TTTTTTGGTCTTGGGACTCTGGG 0: 1
1: 1
2: 12
3: 112
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085486491 Original CRISPR AGGTTGCTCTTCAGGGAGGA TGG (reversed) Intronic
900639587 1:3682318-3682340 AGCTCGCTCTGCAGGAAGGAAGG - Exonic
900912800 1:5613933-5613955 TGGTTGGTCTTCAGATAGGATGG - Intergenic
901852263 1:12023036-12023058 AGGGTGCTCCCCACGGAGGATGG - Intronic
906560910 1:46756183-46756205 AGAATGCTCCTCAGGGTGGAAGG - Intergenic
911179640 1:94849132-94849154 AGGTTATTCTTCAGGGCTGAAGG + Intronic
912774861 1:112499737-112499759 AGGTTGCTATGCAGGGGTGAAGG + Intronic
912975320 1:114324289-114324311 AGGAGGCTGTTCAGGGAAGAGGG - Intergenic
913188262 1:116390027-116390049 AGATTGCTTTTCTGGAAGGAAGG + Intronic
915276819 1:154794755-154794777 AGGTGGCACTGGAGGGAGGAAGG + Intronic
915863897 1:159477584-159477606 AGGTTTCTCTTCAGAAAGAAAGG + Intergenic
916258553 1:162816712-162816734 TAGTTGTTCTTCAGGAAGGATGG + Intergenic
916380709 1:164207759-164207781 ACGTTGCTCTTCAGGGATGCTGG - Intergenic
916713247 1:167430553-167430575 AGGTTGCCCTTGGGGGAGGAGGG - Intergenic
919801748 1:201358629-201358651 AGGGAGCTCTTGAGGAAGGAAGG - Intergenic
922652757 1:227355406-227355428 AGGTGGATCTTGAGGGAGGTGGG - Intergenic
923291386 1:232549267-232549289 AGGTGGCTGGTCAAGGAGGAAGG - Intronic
1063040155 10:2329624-2329646 AGGTTTCTGTTCTGAGAGGAAGG + Intergenic
1064887590 10:20128088-20128110 AGGCTGCCCTGCAGGGAGCATGG + Intronic
1065195132 10:23257075-23257097 AGGTTGCTCCCCTGGGAGAAGGG + Intergenic
1065585417 10:27212681-27212703 TGGTAGCTACTCAGGGAGGATGG - Intronic
1065708047 10:28489284-28489306 AGGTTCCCCTTCAGGAATGAAGG + Intergenic
1065902419 10:30220606-30220628 AGGAGGCTCTTCAGGGAAGGCGG - Intergenic
1066724998 10:38382394-38382416 TAGTTGTTCTTCAGGAAGGATGG + Intergenic
1067163838 10:43849081-43849103 AGGTGGGTCTTCAGGGATAAAGG + Intergenic
1067291423 10:44946229-44946251 AGGTGCCTCTTCAGGGAAGCAGG - Intergenic
1067851978 10:49760181-49760203 AGATTCCACTGCAGGGAGGAGGG + Intronic
1068021994 10:51596407-51596429 AGGTTACTCTTCATGGAAAATGG - Intronic
1068547359 10:58363399-58363421 AGGTTTCTCTGCAGGTACGAAGG - Intronic
1069685090 10:70312794-70312816 TCGGTGCTCTCCAGGGAGGAGGG + Intronic
1069847230 10:71380668-71380690 AGCCTGCCCTTCTGGGAGGAAGG + Intergenic
1071418976 10:85470054-85470076 AGGGTGCACTTCAGGGTAGAGGG + Intergenic
1071476358 10:86028706-86028728 AGGTGGCTTTTCAGAGAGAAGGG - Intronic
1073176709 10:101561388-101561410 AGGGTGCTGGACAGGGAGGATGG - Intergenic
1075441168 10:122480351-122480373 AGGAAGCTCTGCAGGGAGAAGGG + Intronic
1075960788 10:126566522-126566544 AGGTGGCTCTTCAGGGAGCCTGG - Intronic
1076776348 10:132700070-132700092 AGGCTGCTCTTCCTGGGGGAGGG - Intronic
1078653159 11:13214733-13214755 AGCTGGCTCTTGAGGGAGGCTGG + Intergenic
1079032842 11:16998369-16998391 AGGTTGCTCCTTGGGGAGGGAGG - Intronic
1079069591 11:17332520-17332542 TGGTTTCTCTTCAGGGAGAGAGG - Intronic
1081525539 11:43925158-43925180 AGGCTTCTCTGCTGGGAGGAGGG + Intergenic
1083116634 11:60466185-60466207 GGATTTCTCTCCAGGGAGGAAGG + Intronic
1083547576 11:63560382-63560404 AAGTTGCTCTTCAGGGGACAAGG + Intronic
1084582375 11:70032080-70032102 AGCTTGCAGTCCAGGGAGGAAGG + Intergenic
1084672025 11:70612655-70612677 GGGTGCCTCTGCAGGGAGGAAGG - Intronic
1085288649 11:75381196-75381218 AGGCTGCTCATCTGGGAGGCTGG + Intergenic
1085414693 11:76312262-76312284 AGGATGGTCTTAAGGGAGGAAGG + Intergenic
1085486491 11:76868131-76868153 AGGTTGCTCTTCAGGGAGGATGG - Intronic
1088889180 11:114031324-114031346 AGGTTGCTTTTCCAGCAGGAGGG + Intergenic
1089457529 11:118634247-118634269 AGGCTGAACTTCAGGGATGAGGG - Intronic
1089863473 11:121611318-121611340 AAGTTGTTCTTCATGGGGGAAGG - Intronic
1092286821 12:7133395-7133417 AGGTTGCTGCTCAGGGAAGCTGG + Intronic
1095568203 12:43650928-43650950 AGGTCCCTCTTCAAGGAGGAAGG + Intergenic
1095623509 12:44285604-44285626 ACGTTGCTCTTTAGGAAGTAGGG - Intronic
1096671365 12:53200277-53200299 AGGATGCACTTCTGGCAGGAGGG + Exonic
1104442830 12:128808829-128808851 GCGATCCTCTTCAGGGAGGATGG + Exonic
1104604073 12:130175239-130175261 AGGCTGATCTTCAGACAGGACGG + Intergenic
1104749518 12:131229550-131229572 AGGTGGGTCTGCAGGGAGGCCGG - Intergenic
1105447451 13:20470064-20470086 AGCCTGCTTTGCAGGGAGGACGG - Intronic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1107421923 13:40255207-40255229 CTGTTGCTCTTTAGGGAGAAAGG + Intergenic
1110243169 13:73290998-73291020 AAGTTGTTCTTCAAGCAGGAAGG - Intergenic
1110415821 13:75251142-75251164 AGGTTTCTTTGCAGGGAGGTGGG - Intergenic
1112204022 13:97306235-97306257 AGGTTGCCCTGCAGTGAGCAAGG - Intronic
1114773057 14:25450895-25450917 AGATTGCCCTTCAGGGAAGAAGG - Intergenic
1115456852 14:33613691-33613713 AGGAAACGCTTCAGGGAGGAGGG - Intronic
1118315605 14:64724083-64724105 GTGGTGCTCTTCAGGTAGGAAGG + Intronic
1121133757 14:91475089-91475111 AGGTCCTTCTTAAGGGAGGAGGG - Intronic
1121224047 14:92308349-92308371 TGGTAGCTCCTCAGGGAGTAAGG - Intergenic
1121423539 14:93832408-93832430 AGATTGATCTTGAGGGAGGGAGG + Intergenic
1121609002 14:95262928-95262950 AGCTTGTTCTTCTGGGAGGTAGG + Intronic
1122353989 14:101112605-101112627 AGGCTCCTCTTCAGGGAGCAGGG + Intergenic
1124627118 15:31314512-31314534 AGCTTCCTCTGAAGGGAGGAGGG - Intergenic
1125160935 15:36642841-36642863 TGGTTGCTATACAGTGAGGAGGG + Intronic
1125737893 15:41941057-41941079 AGGTTGCTCTGCAGATAGTATGG - Intronic
1125969884 15:43903216-43903238 AGGTTTGGCTTCAGTGAGGAGGG + Intronic
1126119654 15:45240403-45240425 AGGAGGCTCCTCAGGAAGGAGGG + Intergenic
1128178642 15:65580459-65580481 AGGAAGCTCTGCAGGGAGGATGG + Intronic
1128309221 15:66620162-66620184 TGGTTGTCCCTCAGGGAGGAAGG - Intronic
1129555868 15:76508837-76508859 AGTTGTCGCTTCAGGGAGGAAGG - Intronic
1129969750 15:79767953-79767975 AGGTTCCACATCAGGAAGGAAGG - Intergenic
1130723407 15:86412539-86412561 AAGTTGCTCTTGAGTGTGGAAGG + Intronic
1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG + Intergenic
1134252454 16:12583877-12583899 GGGATGCTTTTCAGGGATGAGGG - Intergenic
1137508904 16:49081011-49081033 TGGTTCCTCTTCTGGGAGTAAGG - Intergenic
1137709355 16:50555575-50555597 AGGAGGCTCTTCAGGGACCAGGG + Intronic
1137974017 16:53015126-53015148 AGGATGCTCTGCAGGGCTGAGGG - Intergenic
1138414286 16:56862502-56862524 AAGTTGCTCTTCCTGGAGGCAGG - Intergenic
1138536572 16:57663505-57663527 GAGTTGCTCTTCAGAGGGGAGGG - Exonic
1138656194 16:58492909-58492931 TGGTGGCTCTGCAGGGAGGAGGG - Intronic
1138894738 16:61189789-61189811 TGGTTGCTCTCCAGGGAGAGTGG + Intergenic
1139192525 16:64881131-64881153 AGTGTGCTCTTTAGAGAGGAAGG - Intergenic
1139738853 16:69017509-69017531 AGGTTCCTTGTCAGGAAGGAAGG - Intronic
1141541522 16:84726535-84726557 AGGCTATGCTTCAGGGAGGAAGG + Intronic
1141860358 16:86712270-86712292 AGGGTGCTCGGGAGGGAGGAGGG - Intergenic
1142119580 16:88379387-88379409 GGGGTGCTCTGCAGGGAGCAGGG - Intergenic
1142604766 17:1075310-1075332 AGGTTGGTCATCTGGGAAGAAGG + Intronic
1143156638 17:4841473-4841495 AGGTGGCTCTTGAAGGAGGTGGG - Intronic
1143514543 17:7413280-7413302 AGGTTGACCTTCTGGCAGGAGGG + Intronic
1143961261 17:10722757-10722779 AGGGTGTTCTTCAGGGTGAAGGG - Intronic
1144142841 17:12366223-12366245 AGTTTGTTCTACATGGAGGAGGG + Intergenic
1145211968 17:21020621-21020643 AGTCTGCTCTCCTGGGAGGAAGG + Intronic
1145992982 17:29090281-29090303 AGATTGCCCTTCAGAGAGAAAGG + Intronic
1146054798 17:29575696-29575718 AGCTTGCTCTGGAGGGCGGAGGG + Exonic
1146156272 17:30526548-30526570 TGTTAGCTCTTAAGGGAGGAGGG + Exonic
1146379047 17:32314985-32315007 GGGTTGCTGGTCAGTGAGGAAGG + Intronic
1146574666 17:33980598-33980620 AGGTCCCTCTTCAAGAAGGAAGG + Intronic
1148816475 17:50331567-50331589 AGGGTACTCTCCAGGAAGGATGG + Intergenic
1150134903 17:62690160-62690182 AGCTTATTCTTCGGGGAGGAGGG - Exonic
1150269573 17:63854919-63854941 AGGTAGCTGGTCAGTGAGGAAGG + Intergenic
1151396252 17:73825046-73825068 AGATTGTTCTTCAGGGTTGAGGG + Intergenic
1151908677 17:77066806-77066828 AAGTCACTATTCAGGGAGGATGG - Intergenic
1152545256 17:80997203-80997225 AGGTGGCCCCTCAGGGAGGAAGG - Intronic
1155335721 18:24763603-24763625 AGGTTCCTCTGCAGGCAGGATGG - Intergenic
1156051633 18:32943107-32943129 AGGTTGCCTTTCAGGGAACATGG + Intronic
1157805513 18:50654950-50654972 AGTTTGCTCTTTGGGGAGGAGGG + Intronic
1160306574 18:77745500-77745522 AGGTTGCTGTTGAGTGTGGAAGG + Intergenic
1160544205 18:79641997-79642019 AGGTTCCTCCTCAGGGCGGAGGG - Intergenic
1161062094 19:2220265-2220287 CTGCTGCTCTTCAGGCAGGAGGG + Intronic
1161137790 19:2630348-2630370 AGGTTGCTTTTCAGGAAAGAAGG + Intronic
1161404117 19:4082177-4082199 AGCTTGGTATTCCGGGAGGAAGG + Intergenic
1161618698 19:5286932-5286954 AGGCTGCTTCTCAGGAAGGAGGG + Intronic
1164677178 19:30109386-30109408 AGGTTGCTTTTCAGGGGTCAAGG - Intergenic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925131620 2:1497627-1497649 TGGCTGCTGTTCTGGGAGGAAGG + Intronic
925194055 2:1908976-1908998 ACTTTTCTATTCAGGGAGGAAGG + Intronic
925422064 2:3720377-3720399 ATGTGGCTCTTTAGGGAGGCAGG - Intronic
926419865 2:12685838-12685860 ACCTGGCCCTTCAGGGAGGAAGG + Intergenic
927291553 2:21409368-21409390 AGCTGGATCTTGAGGGAGGAAGG - Intergenic
927462539 2:23311497-23311519 AGTTTGCTCTTCTGGAAGAAGGG - Intergenic
928924452 2:36563809-36563831 AGGAAGCGGTTCAGGGAGGAGGG - Intronic
929447373 2:42011802-42011824 AGGTTGTGATTTAGGGAGGAAGG + Intergenic
929964718 2:46525507-46525529 AGCTTGCTCGCCAGGGAGCAGGG - Intronic
930103542 2:47621022-47621044 AGGCAGCTCTCCTGGGAGGAGGG - Intergenic
930544604 2:52750667-52750689 AGGTTTCTGCTCAGGGTGGAGGG - Intergenic
932049985 2:68388845-68388867 TGGTTGCTTTGAAGGGAGGAGGG - Intronic
932466179 2:71925781-71925803 CAGTGGCTCTTCAGGGTGGATGG + Intergenic
932996611 2:76862592-76862614 AGGTTGCGCTTTGAGGAGGAGGG + Intronic
933253008 2:80049915-80049937 AGGTTGGTCTTTAGAGGGGAGGG - Intronic
933777635 2:85780527-85780549 AGGCTGCTCACCAGAGAGGAGGG - Intronic
934128954 2:88927903-88927925 AGGTTGCTATTCAGAAAGGAAGG + Intergenic
935022498 2:99245202-99245224 AGGTTGAGCTTCTGTGAGGAGGG + Intronic
935873822 2:107484510-107484532 AGGTTACATTTCAGGGAGGGGGG - Intergenic
939348342 2:140998227-140998249 AAGTTGCTCTCCTGGGAGTAAGG + Intronic
941064972 2:160891740-160891762 GTGGTGCTGTTCAGGGAGGAGGG - Intergenic
946165782 2:217863003-217863025 AGGGGTCTCTCCAGGGAGGAAGG + Intronic
946220808 2:218224864-218224886 AAGTTGCTCTCCAGGGATGCTGG - Intronic
947669997 2:231929921-231929943 ACCTTGCCCTTCTGGGAGGAGGG - Intergenic
1169977176 20:11342812-11342834 AGGCTGCTCCTGGGGGAGGAGGG + Intergenic
1169984714 20:11430961-11430983 AGGCTGCTTTTCAGAGAGGATGG + Intergenic
1172115740 20:32572602-32572624 AGGCTGGTCATCGGGGAGGAGGG - Intronic
1172383338 20:34515203-34515225 TAGCTGCTCTTCAGTGAGGAAGG - Intergenic
1173018875 20:39250473-39250495 AGGTGGCACTTCATGGAAGAAGG - Intergenic
1173175763 20:40763583-40763605 AGGTTGCTTTCCAGGTAGAAGGG + Intergenic
1174124845 20:48296895-48296917 AGGAAACGCTTCAGGGAGGAGGG - Intergenic
1175741318 20:61421503-61421525 AGGTTGCGTTTCAGGATGGAGGG + Intronic
1178791148 21:35701373-35701395 AGGTTGCTCTTCAGGGTTGCGGG - Intronic
1179716600 21:43291744-43291766 AGCTTGGGCTGCAGGGAGGAGGG - Intergenic
1179986939 21:44927426-44927448 GGGGTGCTCTCCAGGCAGGAAGG - Intronic
1181433547 22:22897174-22897196 AGGGTGCTCTGCGGGCAGGAGGG - Intergenic
1183258826 22:36781050-36781072 ATGCTGCTCTTCAGGGATGTCGG - Intergenic
1183633190 22:39045744-39045766 AGGTTGCTCTGGAGGCAGAAGGG - Intronic
1183638945 22:39081814-39081836 AGGTTGCTCTGGAGGCAGAAGGG - Intronic
1183666456 22:39249036-39249058 AAGATGCTCTTCATGGATGAGGG - Intergenic
1184608814 22:45589809-45589831 AGGGTGCTCTGCGGGGAGGGTGG - Intronic
1184726720 22:46351501-46351523 GGCGTGCTCTTCAGGGAAGATGG - Intronic
1184879491 22:47295946-47295968 GTGTTGCTCTTTAAGGAGGAGGG - Intergenic
949940806 3:9152725-9152747 AGATTCCCCTTCAGGAAGGAAGG + Intronic
950342150 3:12257230-12257252 AGCTTGCTCTACAGGAAGCATGG + Intergenic
952387835 3:32855654-32855676 AGGTTCATCTTCAGGGATGGTGG + Intronic
952448108 3:33403354-33403376 AGGCTGCTCATTAGGGAAGAGGG - Intronic
952520014 3:34147180-34147202 AGTTAGCTCTTCTGGTAGGAGGG + Intergenic
956950572 3:74277429-74277451 AGGTTTCACTTCAGGGATGCAGG + Intronic
957115996 3:76027477-76027499 TGGTTGCTCTTTAGGAAAGAGGG - Intronic
960944642 3:122957825-122957847 AGTTTGTCCTCCAGGGAGGATGG - Intronic
961240874 3:125410265-125410287 CTCTTGCTCTTCAAGGAGGAAGG - Intergenic
961829642 3:129616899-129616921 AGGCTGCTCTTGAGTAAGGAGGG - Intergenic
962388976 3:134956069-134956091 AAGTTGGACTGCAGGGAGGAAGG + Intronic
962407013 3:135109113-135109135 AGGGAGCACTACAGGGAGGAAGG - Intronic
967885485 3:194330834-194330856 AGCCTGCTCTTCTGGGAGCAGGG - Intergenic
968093688 3:195913302-195913324 AGGTTTCTATTCTAGGAGGAGGG - Intergenic
969103843 4:4790275-4790297 AGGTTCTTCCACAGGGAGGAAGG + Intergenic
971251095 4:24974152-24974174 AGTTTGCTCCCCAGGGCGGAAGG + Intronic
973149220 4:46866406-46866428 AGGTAGCTCTCCAGGGAGTCAGG - Intronic
975839038 4:78454919-78454941 AGGGTGCTGTTCCAGGAGGAGGG - Intronic
977299524 4:95252418-95252440 GGGCTGCTCTTCAGAGAAGAGGG - Intronic
979614103 4:122722188-122722210 AGGTGGCTCTCCAGAGAAGAGGG - Intergenic
979929730 4:126616485-126616507 TGGTTCCTCTTCATGGAAGAGGG - Intergenic
981202375 4:141995773-141995795 ATGTTGCTGTGAAGGGAGGAGGG - Intergenic
981231083 4:142356541-142356563 AGGTTGCTCTTGAGTTAGTAAGG + Intronic
981259028 4:142697307-142697329 AGGTAGCTTTTCTGGGAGCAAGG - Intronic
983225994 4:165086779-165086801 AGCCTGCTCTTCAGGGATGATGG - Intronic
985032042 4:185799214-185799236 AGGTGGCTCTTCTTGGTGGAAGG - Intronic
986139657 5:5017776-5017798 AGGTCTCTCTTAAGGGAAGAGGG + Intergenic
986327236 5:6685262-6685284 AGGTTGGCTTTCGGGGAGGAAGG + Intergenic
986357449 5:6942722-6942744 TGGATGCTCTTCAGTAAGGATGG + Intergenic
986558059 5:9031567-9031589 AGTTTGAGCTTCAGGGAGGGGGG + Intergenic
996884693 5:128341441-128341463 AGGTCCCTCTTCAGGAAAGAAGG + Intronic
999204909 5:149840848-149840870 ATGTGGCACTTCAGGGAGGAGGG + Intronic
999715492 5:154356748-154356770 AGGTCCCTCATTAGGGAGGAAGG + Intronic
999917372 5:156277587-156277609 AGTTTACTCTTCAGAGAGGTGGG + Intronic
1001451020 5:171824443-171824465 AGGATGCTCTGCAGGGTAGAAGG - Intergenic
1001580308 5:172793744-172793766 TGCTTGAGCTTCAGGGAGGAAGG - Intergenic
1001771789 5:174302391-174302413 AGATGGGGCTTCAGGGAGGAGGG - Intergenic
1002015630 5:176319800-176319822 AAGTTGCTTTTTTGGGAGGAAGG + Intronic
1002094210 5:176821571-176821593 AGTTGGCTCTTCAGGCAGGCTGG + Intronic
1003025821 6:2555062-2555084 AAGATGCTCTTCGGGGAGGAGGG - Intergenic
1003783267 6:9453813-9453835 AGGTTGCTTTTCAGGAACAATGG + Intergenic
1004499999 6:16200785-16200807 ATGGTGCACTTCAGGGAGGTTGG + Intergenic
1005085929 6:22006626-22006648 TGGTTGCCCTTGAGGAAGGAAGG + Intergenic
1005413347 6:25574317-25574339 AGGTGGCTCTTCAGGGTGTTAGG - Intronic
1005955410 6:30660011-30660033 AGGTGCCCCCTCAGGGAGGATGG - Exonic
1008811887 6:55512203-55512225 AGCTTGCTCTTCAAATAGGAAGG - Intronic
1010251721 6:73714181-73714203 AGATCGCTCTTTAGGGATGAAGG + Intronic
1011823570 6:91280585-91280607 ATGTGGTTCTTCAGGGAGGCTGG + Intergenic
1012431661 6:99170573-99170595 AGCTTCCTCTTCTGTGAGGAAGG + Intergenic
1012646713 6:101693301-101693323 ATTTTGCTCTTCAGGGTGAAGGG - Intronic
1017018308 6:150118924-150118946 AGGAAGCTCTTCAGGGAGCAAGG + Intergenic
1017970030 6:159304164-159304186 TGGTTACTTTTCAGGGAAGATGG - Intergenic
1018797618 6:167199585-167199607 AGGTTGCTCTTCACTGGGTAGGG - Intergenic
1019949404 7:4359216-4359238 AGATTGCTCTGCAGGGACTAAGG + Intergenic
1022677734 7:32515399-32515421 AGGATTCTCTGGAGGGAGGAGGG - Intronic
1022895010 7:34741024-34741046 AGGTTTCTCTTCAGGAATTATGG - Intronic
1024678687 7:51661189-51661211 TGGATGTTCTTCAGAGAGGATGG - Intergenic
1024958021 7:54946412-54946434 ATGCTGCTCTTTTGGGAGGATGG + Intergenic
1025249403 7:57342038-57342060 ATGTTGCTCTTCAGGAATCAAGG + Intergenic
1025802138 7:64796289-64796311 AGGGTGGTCTTCAGAGAGGGTGG + Intronic
1026266240 7:68798291-68798313 GGGCTTCTCTTCAGGGAAGACGG + Intergenic
1027739382 7:81980857-81980879 AGATTGCTCGTTTGGGAGGATGG + Intronic
1028604810 7:92644217-92644239 AGATTACTCTTAAGGCAGGAAGG + Intronic
1029003429 7:97181085-97181107 AAGTTTTTCTTCTGGGAGGAAGG - Exonic
1029942688 7:104496861-104496883 AGTTTTCCCTTCTGGGAGGAAGG - Intronic
1031028492 7:116708811-116708833 ATGTTCCTCTTTGGGGAGGAGGG + Intronic
1031146661 7:118004309-118004331 GGGTGGCACTTCAGGGAGGCAGG - Intergenic
1032012914 7:128358749-128358771 AGCTTCCTCTCCAGGGAGTATGG + Exonic
1033453520 7:141482301-141482323 AGGTGGGTGTTCAGGGAGGAAGG - Intergenic
1034051727 7:147990897-147990919 AGCCTGATCTCCAGGGAGGAGGG - Intronic
1034065514 7:148132997-148133019 AGGATGTTCATCAGGGATGAAGG - Intronic
1034268413 7:149792006-149792028 AGGGAGCTCTGCAGAGAGGATGG - Intergenic
1034377559 7:150659422-150659444 AGGTGGCTCTGGAAGGAGGAGGG - Intergenic
1035185017 7:157119766-157119788 AGGCTGCTCTCCAGGGAAGGCGG + Intergenic
1035724730 8:1817522-1817544 AGGATGCTCTGCAGATAGGACGG - Intergenic
1039253647 8:35694240-35694262 AGGTTGAGCTTCAGTGAGGCTGG + Intronic
1039398502 8:37247653-37247675 GGGTTGCTCTGCAGGGAAGCAGG - Intergenic
1039409808 8:37343224-37343246 AGGATTGGCTTCAGGGAGGATGG - Intergenic
1042109583 8:65366903-65366925 AGGTTGCTCTGGAGTGAGGTAGG + Intergenic
1042622883 8:70725297-70725319 ATGTTGCTCTTTTGGGTGGATGG + Intronic
1042650443 8:71034570-71034592 AGGCTGCTGTGCTGGGAGGATGG + Intergenic
1043661200 8:82744312-82744334 AGGGTGCGCTACAGTGAGGAAGG - Intergenic
1046221454 8:111221827-111221849 AGGTGGCACTTCAGGGAAGCAGG + Intergenic
1046729933 8:117713811-117713833 AGGTTCCTCTCCAGGGAGCAGGG - Intergenic
1047526555 8:125638813-125638835 AGGCAGGGCTTCAGGGAGGAGGG + Intergenic
1048277286 8:133076514-133076536 AGTTTGCTTTACAGGGAAGACGG + Intronic
1048383004 8:133884668-133884690 ATGTTTCTCTTCTTGGAGGATGG - Intergenic
1049070127 8:140349505-140349527 AGGTTCCGCTTCAGAGCGGAAGG + Intronic
1049644787 8:143731413-143731435 AGGTTGCCATTCCAGGAGGAGGG - Intronic
1049803698 8:144529596-144529618 AACTTGCTCTGCACGGAGGACGG + Exonic
1051526722 9:18053170-18053192 AGGTTGGACTTCATGGAGAAGGG + Intergenic
1052153423 9:25150140-25150162 AAGTTGTTCTTCAGTGAGAAGGG - Intergenic
1052396402 9:27943884-27943906 AGGATGTTCTCCAGGGAGAAGGG + Intergenic
1052851419 9:33380692-33380714 AGGTCCTTCTTCAGGAAGGAAGG - Intergenic
1052913983 9:33909757-33909779 AGAAAGCTCTTGAGGGAGGAAGG + Intronic
1053023728 9:34713958-34713980 GGGTTGCTCTTGGGGAAGGATGG + Intergenic
1056839124 9:89983823-89983845 AGGTAGCTCTTCAAGCAGAAAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057383623 9:94589701-94589723 GGGGTGCTGTTCAGGGAAGAGGG - Intronic
1059706144 9:116825490-116825512 TGGTTCCTCTCCATGGAGGAGGG - Intronic
1060404804 9:123367933-123367955 GGGATGGTCTTCAGGGAAGACGG + Intronic
1060520876 9:124293358-124293380 AGCTTCATCTTCAGGGAGGCTGG + Intronic
1060755838 9:126212760-126212782 AAGGTGGTGTTCAGGGAGGAGGG + Intergenic
1061485567 9:130918946-130918968 AGCTGGCTCTGCAGGGAGGGTGG - Intronic
1061572920 9:131488731-131488753 AGCTGGCGTTTCAGGGAGGAAGG - Intronic
1062677980 9:137759508-137759530 AGGTAGCTCTAAAGGAAGGATGG + Intronic
1186326051 X:8477784-8477806 AGAAAGCTCTTCAGGTAGGATGG - Intergenic
1187803556 X:23092929-23092951 AAGTTTGTCTTCAGAGAGGAAGG - Intergenic
1189933609 X:46040973-46040995 TGGTTACTTTTAAGGGAGGAAGG - Intergenic
1190859640 X:54331865-54331887 AGGTTGCTGTTCAGATAGGTTGG - Intronic
1191846159 X:65549730-65549752 AGCTTGCCCTCCAGGGAGCAGGG - Intergenic
1192733812 X:73829104-73829126 ATGTTGATCTTCAGGTGGGAAGG + Intergenic
1197220472 X:123907942-123907964 TGGTTTCTCTTCGGGGAGGGGGG + Exonic
1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG + Intergenic
1200427245 Y:3035003-3035025 AACTTACTCTTCAGGGAAGAGGG + Intergenic
1200857846 Y:7958746-7958768 GGGTTGTTCTCCAGGGAGTAAGG + Intergenic