ID: 1085487341

View in Genome Browser
Species Human (GRCh38)
Location 11:76876557-76876579
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902995100 1:20218358-20218380 CATAGATGATTGATTAGGATTGG - Intergenic
907966095 1:59331311-59331333 CGTAGGTAAAGGATTAGGACTGG + Intronic
910536071 1:88299117-88299139 CCTAGTTAAATGCATAGGATTGG - Intergenic
913219088 1:116645000-116645022 CTTGGGTAAATACTTAGGAGTGG - Intronic
913390794 1:118309508-118309530 GATATGGAGATGCTTAGGATGGG + Intergenic
918143255 1:181735329-181735351 CATAGGTAAAAGCATGTGATAGG + Intronic
918442834 1:184585515-184585537 CATAGGTAAATGCGTGTCATAGG + Intronic
920246909 1:204594928-204594950 AGTATGTAAATGCTTAGAATAGG + Intergenic
921831515 1:219732845-219732867 CATAGGTAAGTGATGAGGACAGG + Intronic
922480477 1:225937257-225937279 CTCACGTAAGTGCTTAGGATGGG + Exonic
923059651 1:230459160-230459182 TTTAGGTAAATACTTAGGAGTGG + Intergenic
923132658 1:231090946-231090968 CATAGGTAAGTACTTAGACTAGG + Intergenic
924106174 1:240651456-240651478 CAGAGGCAAATGCTTAGACTTGG + Intergenic
924161813 1:241240791-241240813 TATAGGTAAACGGCTAGGATCGG + Intronic
924320165 1:242840532-242840554 CAGAGATAAATGCTAAGGAGAGG - Intergenic
1063928359 10:11003317-11003339 CAAAGGTAAATTCTTAACATTGG - Intergenic
1063992775 10:11584213-11584235 CAGAGCTAAATGCTTTGGTTTGG - Intronic
1064343738 10:14510902-14510924 CTTGGGTAAATACTTAGGAGCGG + Intergenic
1066104573 10:32145339-32145361 CCTAGGTAACTGCCTAGGGTTGG + Intergenic
1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG + Intergenic
1066378521 10:34881482-34881504 CTTGGGTAAATGCCTAGGAGTGG - Intergenic
1066499627 10:35978313-35978335 CTTGGGTAAATACTTAGGATTGG + Intergenic
1068872713 10:61962415-61962437 CATATTTAAATGATTAGGAGAGG - Intronic
1069212238 10:65776766-65776788 ATTAGGTAAATGTTTAGGAACGG + Intergenic
1071168386 10:82833654-82833676 CAGTGGTAAATCCTTAGGCTAGG - Intronic
1071410649 10:85389828-85389850 CATAGGTAAATGCGTGCCATGGG - Intergenic
1073033827 10:100549199-100549221 CAAGTGTAAAAGCTTAGGATAGG - Exonic
1073673938 10:105623837-105623859 CTTAGGTAAATACCTAGGAGTGG + Intergenic
1073803847 10:107073721-107073743 CCTAGGTAAATACAGAGGATTGG - Intronic
1073873904 10:107899112-107899134 CACAGAAAAAAGCTTAGGATAGG - Intergenic
1074203854 10:111263969-111263991 AATAGATAAATGTTTAGAATGGG - Intergenic
1074246603 10:111700020-111700042 GATAGGGAAATGCTTATGGTAGG + Intergenic
1076681591 10:132174617-132174639 CTTGGGTAAATACCTAGGATTGG + Intronic
1077657221 11:4031396-4031418 CTTAGGTAAATACCTAGGAGTGG + Intronic
1078688086 11:13551403-13551425 CATAGGAAACAGGTTAGGATTGG + Intergenic
1083523885 11:63342666-63342688 TATAGGTAAATGCTATGGTTTGG - Intronic
1083771153 11:64868336-64868358 CTCAGGTAAATGCTGAGGAACGG - Intronic
1084100756 11:66947126-66947148 CTTGGGTAAATGCCTAGGAGTGG - Intronic
1085487341 11:76876557-76876579 CATAGGTAAATGCTTAGGATTGG + Intronic
1088612244 11:111589129-111589151 CATAATTAATTGCTTAGGCTGGG + Intergenic
1088644558 11:111907226-111907248 CATAGGTAAATGCATGTCATAGG + Intergenic
1095321421 12:40832904-40832926 AGCAGGTAAGTGCTTAGGATTGG - Intronic
1095377728 12:41550812-41550834 CATGGGTAAATCCTTAGCAAGGG - Intronic
1095412879 12:41943818-41943840 AATAGGTAAATGTTTAGCTTTGG + Intergenic
1098987740 12:77030507-77030529 CCTGGATAAATGGTTAGGATGGG + Intronic
1099603933 12:84777820-84777842 CATAGGTAACTGCTAAAGCTGGG + Intergenic
1101085250 12:101229015-101229037 CAAAGGTAAATGGTTATCATAGG - Intergenic
1103536373 12:121636466-121636488 CATATGTAGATGTTTAGCATAGG - Intronic
1106993899 13:35458075-35458097 CTTAGGTATATTCTTAGGAGGGG + Intronic
1107504712 13:41022042-41022064 CTTGGGTAAATGCCTAGGAATGG - Intronic
1107864522 13:44690796-44690818 CATATGTAAACTTTTAGGATCGG - Intergenic
1108234936 13:48393933-48393955 CATAAGAAAATACTTAGGATGGG + Intronic
1110669771 13:78163843-78163865 CATTGGTAAATGCATGGTATTGG - Intergenic
1111786831 13:92798040-92798062 AATACGAAACTGCTTAGGATAGG - Intronic
1111803108 13:93004648-93004670 CATCAGTAAATTCTAAGGATTGG - Intergenic
1114370939 14:22087339-22087361 TATAGATAAATACTTAGGAGTGG - Intergenic
1114861822 14:26532174-26532196 CTTGGGTAAATACTTAGGAATGG - Intronic
1115557377 14:34554151-34554173 CATAGGTAAATTCGTAGGTTAGG + Intergenic
1116038207 14:39655028-39655050 CATAGGTAAATGCGTGTCATGGG + Intergenic
1116689955 14:48093102-48093124 CTAAGGTAAATACCTAGGATTGG + Intergenic
1116986464 14:51225056-51225078 CATAGTAAAGTGCTTAGGAGTGG - Intergenic
1117996063 14:61479411-61479433 CATGGGTAAATGCTGAGGAAGGG + Intronic
1123142862 14:106097950-106097972 AATCTGTAAATGCTTAGGTTAGG + Intergenic
1123190894 14:106568629-106568651 AATCTGTAAATGCTTAGGTTAGG + Intergenic
1202846045 14_GL000009v2_random:176958-176980 CATTGGTATATTCTTAGAATAGG + Intergenic
1123677773 15:22728497-22728519 CTTGGGTAAATACTTAGGAGTGG + Intergenic
1124329975 15:28802761-28802783 CTTGGGTAAATACTTAGGAGTGG + Intergenic
1125178515 15:36853877-36853899 CTTAGGTAAATACTTAAGAGTGG - Intergenic
1126501663 15:49352791-49352813 GATAGGGAACTGCTTGGGATTGG - Intronic
1127334957 15:57975188-57975210 CTTAGGTAAATACCTAGGAATGG - Intronic
1129459853 15:75695133-75695155 GATAGGTAAATGTTTAGCAATGG - Intronic
1130606075 15:85318215-85318237 CATATGTAACTGCATAGCATTGG - Intergenic
1131825002 15:96313521-96313543 AATAGGGAAATGGTTATGATAGG + Intergenic
1132471816 16:108534-108556 CACAGGTAAATGGTTAGCACTGG + Intronic
1135749562 16:25046130-25046152 CTTAGATAAATGTTTAGGAGTGG + Intergenic
1137445695 16:48530824-48530846 CTTAGGTAAATACCTAGGAATGG + Intergenic
1137702795 16:50509047-50509069 CTTGGGTAAATACTTAGGAGTGG + Intergenic
1138948588 16:61882817-61882839 CATAGGTAAATGTGTGGCATGGG - Intronic
1139839117 16:69864061-69864083 CATGGGTAAATACCTAGGAGAGG + Intronic
1140608223 16:76566557-76566579 CTTAGGTAAATGCCTAGAATTGG + Intronic
1141757847 16:86004429-86004451 CTTAGGTAAACGCCTAGGAGGGG + Intergenic
1145851307 17:28100181-28100203 CTTGGGTAAATACTTAGGAATGG + Intronic
1150935269 17:69628414-69628436 CTTAGGTATATACTTAGGAGTGG - Intergenic
1152966054 18:114903-114925 CATGGGTAAATACCCAGGATTGG + Intergenic
1153564386 18:6405027-6405049 CATGTTTAAATGCTTAGGCTAGG + Intronic
1154210028 18:12371574-12371596 AAAAGGTAAATGCTTAGGTGTGG - Exonic
1154927916 18:20957152-20957174 CATGGGTAAATACCCAGGATTGG - Intronic
1155777856 18:29791050-29791072 CATAGGTAAATGCATATCACGGG + Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1164045672 19:21537968-21537990 CATAAGAAAATTCATAGGATGGG + Exonic
1164098066 19:22029599-22029621 CATAGGAAAATGATAAGCATTGG + Intergenic
1166955347 19:46460631-46460653 CTTAGGTAAATACTTAGGAGTGG + Intergenic
928182273 2:29077047-29077069 CTTGGGTAAATTCTTAGGAGTGG - Intergenic
928397885 2:30956999-30957021 CAGGGACAAATGCTTAGGATGGG - Intronic
928417304 2:31106593-31106615 CAGAGGTAAATGCTTGGGAAAGG - Intronic
930209074 2:48616038-48616060 TATTTCTAAATGCTTAGGATTGG - Intronic
930613596 2:53570585-53570607 CATAGGTAAATACCTAGGATTGG + Intronic
930630564 2:53749438-53749460 CTTGGGTTAATACTTAGGATTGG - Intronic
931947818 2:67331024-67331046 CTTGGGTAAATACTTAGGAATGG - Intergenic
933010361 2:77054550-77054572 CATAGCTAAATAGCTAGGATAGG + Intronic
933032649 2:77350967-77350989 CATAGGTAAATGCATGTCATGGG + Intronic
933906065 2:86893981-86894003 CTTGAGTAAATGCCTAGGATTGG + Intergenic
935034056 2:99351458-99351480 CTTAGGTAAATACCTAGGAGTGG + Intronic
935596403 2:104881459-104881481 CATATGAAAAAGATTAGGATGGG - Intergenic
935766908 2:106377151-106377173 CTTGAGTAAATGCCTAGGATTGG + Intergenic
936366097 2:111857676-111857698 CTTGAGTAAATGCCTAGGATTGG - Intronic
941055916 2:160787939-160787961 TATAAGTAAATACTTAGGAGTGG - Intergenic
941711710 2:168721457-168721479 CATAGGCATATGCTTAGGAATGG + Intronic
941870854 2:170383970-170383992 CATAGGTAAAGCCATAGCATCGG + Intronic
946469939 2:219949786-219949808 CTTGGGTAAATTCTTAGGAGTGG - Intergenic
947525406 2:230874229-230874251 CAAAGTTAAACGCTTAGGAGTGG - Intronic
1168981895 20:2011370-2011392 CTTTGGTATATGTTTAGGATTGG - Intergenic
1170786107 20:19469050-19469072 CAAAGGGCAATGCTTAGGAGGGG + Intronic
1171019516 20:21572450-21572472 CATTTGTAAATGCATAGGAAAGG - Intergenic
1172041410 20:32048975-32048997 CTCGGGTAAATACTTAGGATTGG - Intergenic
1173338055 20:42129156-42129178 CATATAAAAATGCTTAGGACAGG + Intronic
1178955975 21:37022252-37022274 CATAGGTAAATGCATATCATGGG + Intergenic
1180121711 21:45755412-45755434 CATAGGTAAATACCTAGGAGTGG + Intronic
1180370462 22:12030481-12030503 CCTTGGTAAATTCTTAGAATAGG + Intergenic
1180820377 22:18823056-18823078 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1181206601 22:21257528-21257550 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1182110464 22:27719499-27719521 AATAAATAAATGCTTAGCATGGG - Intergenic
1184932198 22:47689761-47689783 CCTAGGTACATGCCTAGGAGTGG + Intergenic
949537685 3:5008423-5008445 CATAGGCCCATGCTTAGGAAAGG - Intergenic
950909279 3:16571370-16571392 CTTGGGTAAATGCATAGGAGTGG - Intergenic
951470420 3:23050516-23050538 CATAGGTAAATGTGTATCATGGG - Intergenic
951904937 3:27695970-27695992 CTTTGGTAAATACTAAGGATTGG - Intergenic
952173208 3:30832672-30832694 CATAGGTACACATTTAGGATGGG - Intronic
953499773 3:43421979-43422001 TGCAGGTAAATGCCTAGGATTGG - Intronic
954606967 3:51919459-51919481 CTTGGGTAAATACTTAGGACTGG - Intergenic
954838162 3:53489519-53489541 AATAAGTAAATGGTTAGGCTGGG - Intergenic
960963407 3:123088424-123088446 CATCCCTTAATGCTTAGGATGGG - Intronic
962038182 3:131676428-131676450 CATAAGTAAATGCGTTGAATGGG + Intronic
962922403 3:139962895-139962917 CATGGGTAAATACCTAGGAATGG + Intronic
963131217 3:141860013-141860035 CTGGGGTCAATGCTTAGGATAGG - Intergenic
964140015 3:153387207-153387229 CTTAGGTAAATGTATAGGAGTGG - Intergenic
966164708 3:177004650-177004672 CTTGGGTAAATGCATAGGAATGG - Intergenic
966671063 3:182526601-182526623 AATAAATAAATGCTTAGCATGGG - Intergenic
966707417 3:182931668-182931690 TTTAGGTATATGCCTAGGATTGG - Intergenic
966895527 3:184441874-184441896 CATGGGGTAATGCTTATGATAGG + Intronic
968092204 3:195906311-195906333 CTTAGGTAAATCCCTAGGACCGG - Intronic
968601207 4:1510408-1510430 CCTGGGTAAATGCCTAGGAGTGG + Intergenic
970329876 4:14969647-14969669 CCTAGGTAAATGCATTGAATGGG + Intergenic
973093188 4:46164067-46164089 CATAGGTAAATGTTTGTCATGGG - Intergenic
975461013 4:74652823-74652845 CTTTGGAAAATACTTAGGATTGG + Intergenic
977134413 4:93284450-93284472 CATAGGTAAATGTGTATCATAGG - Intronic
977418377 4:96764241-96764263 CATAGGTAAAAGCTGTGAATGGG + Intergenic
977426522 4:96873582-96873604 CAAAGGTAAATGCTTTAAATAGG - Intergenic
979972474 4:127153933-127153955 CTTGGGTAAGTGCTTAGGAGTGG - Intergenic
980203306 4:129684405-129684427 CATAGGTAAATACTATGGAAGGG - Intergenic
980411112 4:132420298-132420320 TATGGGTAAATACTTAGGAGTGG + Intergenic
984007028 4:174324392-174324414 CTTGGGTAAATGCCTAGGAGTGG + Intronic
984052553 4:174883883-174883905 CATATGTAAATGTTGTGGATTGG + Intronic
985873078 5:2574368-2574390 CTTAGGCAACTGCTTAGGAGTGG - Intergenic
985946211 5:3186055-3186077 TATAGGTAAATGCATAGGGCTGG - Intergenic
987614282 5:20252515-20252537 CACAGGTAAATGATTATAATAGG + Intronic
988711745 5:33785804-33785826 CTTAAGTAAATATTTAGGATTGG - Intronic
989401388 5:41011354-41011376 AATAGGTAAAGGCTTACAATAGG - Intronic
989528990 5:42484790-42484812 CATAGGAAACTGCATAGGAAAGG - Intronic
992536098 5:77705498-77705520 CATATGTAAATCCTTATGAAGGG + Intronic
994545425 5:101161218-101161240 CATAGGTAAATGCATATCATGGG + Intergenic
995316357 5:110778949-110778971 CATAGGTACATGCCTAGTAATGG + Intergenic
995906108 5:117125597-117125619 CTTAGGTATATGCTTAGAAATGG + Intergenic
997276322 5:132595099-132595121 CACAGGTAACTGTTAAGGATGGG + Intronic
998479231 5:142447955-142447977 CTTAGGTAAATACCTAGGAGTGG + Intergenic
998542943 5:143000265-143000287 CTTAGGTAAATACCTAGGAGTGG - Intronic
998711512 5:144830988-144831010 CCTTGGTAAAATCTTAGGATAGG + Intergenic
999700383 5:154222469-154222491 CTTGGGTAAATACTTAGGAATGG + Intronic
1000715829 5:164642997-164643019 CATTGGTCAATGCCTAGCATAGG + Intergenic
1003372516 6:5542414-5542436 CTTAGGTAAATACTTAGGAATGG + Intronic
1003745760 6:9000210-9000232 CATAGGTAAATGTGTATCATGGG + Intergenic
1005289994 6:24370376-24370398 CTTGGGTATATGCTTAGGAATGG - Intergenic
1006207881 6:32365529-32365551 CATAGTTGAATGGTTAGGAGAGG - Intronic
1007421347 6:41721678-41721700 CATAGTAAAATGCTTAGCACAGG - Intronic
1008241592 6:49119404-49119426 CTAAGTTAAATGCTAAGGATGGG - Intergenic
1008706313 6:54164963-54164985 CTTGGGTAAATACTTAGGAGTGG + Intronic
1009451124 6:63801679-63801701 CATAGGAAGAGGCTTAGGTTAGG + Intronic
1010631379 6:78202505-78202527 CAAAGGTAAAGGCTTAAAATGGG + Intergenic
1011004676 6:82630507-82630529 CATAGCTGCATGATTAGGATTGG + Intergenic
1014297339 6:119636094-119636116 CTTAGGTAAATACCTAGCATTGG - Intergenic
1016203308 6:141440386-141440408 CTTGGGTAAATGCCTAGGATTGG + Intergenic
1016565662 6:145450447-145450469 GCTGGGTAAATGCTTAGGAGGGG - Intergenic
1019407073 7:889425-889447 CATAGGTAAAGGTTTGGGAGTGG + Intronic
1020851220 7:13355792-13355814 CCTAGGTAAATACCTAGGAGAGG - Intergenic
1022371878 7:29779171-29779193 CACAAGTACTTGCTTAGGATTGG - Intergenic
1023664604 7:42509921-42509943 CTTTGGTAAATACTTAGGAGTGG - Intergenic
1024894362 7:54240338-54240360 CATACCTAAATGCTTAGGCCAGG - Intergenic
1024939275 7:54745375-54745397 CAAAGGTAAATCTTGAGGATAGG - Intergenic
1028565745 7:92228637-92228659 CATAGGTAAATTCTTGTCATGGG + Intronic
1028735668 7:94209531-94209553 CATAAATAAATGCTGGGGATGGG - Intergenic
1029802623 7:102965269-102965291 CATGGTTAAATGGCTAGGATGGG - Intronic
1030313127 7:108087719-108087741 GAGAGGTAAATGCTGAGGAGTGG - Intronic
1030522367 7:110613928-110613950 CTTAGGTAAATACCTAGGAGGGG - Intergenic
1030704042 7:112672788-112672810 CTTGGGTAAATACTTAGGAGTGG + Intergenic
1031101271 7:117483217-117483239 CAAAGGCAAATGTTTAGAATAGG - Intronic
1031624662 7:123978141-123978163 CCTCGGTAAATGCCTAGGAGTGG - Intergenic
1035857160 8:2987941-2987963 CATAGGTAAATGTGTACCATGGG + Intronic
1037357872 8:18041853-18041875 CATGAGTAAATACCTAGGATTGG + Intergenic
1038652304 8:29416442-29416464 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1042587979 8:70363434-70363456 CATAGGTAAATATCTAGGAGTGG - Intronic
1043402037 8:79893035-79893057 CAGAGGTAAAAGCTAAGGCTGGG - Intergenic
1044766386 8:95579770-95579792 CTTAGGCAAATGCCTAGGAATGG - Intergenic
1045389806 8:101704352-101704374 CAGAGTTAAATGCATAGGACTGG + Intronic
1046392178 8:113588941-113588963 CATAGGTAAATGTGTATCATGGG - Intergenic
1048536301 8:135298892-135298914 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1049119447 8:140721444-140721466 CATTGGTAAATTCTCAGGACTGG - Intronic
1050219960 9:3376325-3376347 CATGGGTAAATACCTAGGAGTGG - Intronic
1051810452 9:21042947-21042969 CTTAGGTAAATATTTAGGAATGG + Intergenic
1053339839 9:37315832-37315854 TATAGGTAAATGCAAAGGAAAGG + Intronic
1054702348 9:68425573-68425595 AATAGGATAATGCTTAGGATAGG - Intronic
1054988525 9:71292851-71292873 GATATGTGAATGATTAGGATTGG - Intronic
1055288829 9:74761249-74761271 CCTTGGTAAATACTTAGGAACGG - Intronic
1056058634 9:82859182-82859204 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1057456911 9:95221977-95221999 CTTGGATAAATGCCTAGGATTGG - Intronic
1057523625 9:95780506-95780528 CATAGGGCCATGCTTAGGGTTGG - Intergenic
1057596629 9:96419554-96419576 CATTGGTTAAGGGTTAGGATTGG + Intergenic
1058537008 9:105971966-105971988 CATAGCTAAATGCAAAGTATAGG - Intergenic
1059347721 9:113641606-113641628 CTACGGTAAATGCTTAGGAGTGG + Intergenic
1059477991 9:114563456-114563478 GCTATGTAAATACTTAGGATTGG + Intergenic
1060897958 9:127230850-127230872 CCTAGGGAAATGGTTAGGATTGG + Intronic
1185625448 X:1478179-1478201 TACAGAGAAATGCTTAGGATTGG - Intronic
1186399931 X:9248342-9248364 CTTAGGTAAATACCTAGGAGTGG - Intergenic
1186572797 X:10733936-10733958 TTTAGGTAAATACTTAGGAGTGG - Intronic
1187024065 X:15414875-15414897 CATATTTAAATTCTTAGAATAGG + Intronic
1187124548 X:16442342-16442364 CTTAGGTAGATACTTAGGAGTGG - Intergenic
1188320090 X:28725490-28725512 CATAGGTCAAGGCATGGGATAGG + Intronic
1188760729 X:34026544-34026566 CATAGGTAAATGTTTGTCATGGG + Intergenic
1188998593 X:36917219-36917241 CATAGGTATGTGCTTGGGTTTGG - Intergenic
1191712688 X:64167404-64167426 CCTGGGTGAATACTTAGGATTGG + Intergenic
1192275476 X:69626294-69626316 CTTAGGTATATGCCTAGGAGTGG - Intronic
1192670014 X:73129944-73129966 CATAGGAAGATGCTCATGATAGG - Intergenic
1194476558 X:94366203-94366225 CATGGGTAAATACTTACGTTTGG + Intergenic
1194766541 X:97848835-97848857 AAAAGGCAAATGATTAGGATGGG - Intergenic
1195700911 X:107704933-107704955 CTCAGGTGAATGCTTAGGACTGG + Intergenic
1196403893 X:115344664-115344686 CATAGGTGAGTGTTTAGAATAGG - Intergenic
1198490984 X:137141367-137141389 CCTTGGTAAATACTTAGGAGGGG + Intergenic
1200362221 X:155620335-155620357 CTTGGGTAAATACTTAGGAGTGG - Intronic
1200685070 Y:6250709-6250731 CATAGGAAAATGTTGAGGAAAGG + Intergenic
1200990596 Y:9341979-9342001 CATAGGAAAATGTTGAGGAAAGG + Intergenic
1200993258 Y:9362296-9362318 CATAGGAAAATGTTGAGGAAAGG + Intronic
1200995916 Y:9382567-9382589 CATAGGAAAATGTTGAGGAAAGG + Intergenic
1200998580 Y:9402919-9402941 CATAGGAAAATGTTGAGGAAAGG + Intergenic
1201001090 Y:9471449-9471471 CATAGGAAAATGTTGAGGAAAGG + Intronic
1201003754 Y:9491777-9491799 CATAGGAAAATGTTGAGGAAAGG + Intergenic
1201006410 Y:9512058-9512080 CATAGGAAAATGTTGAGGAAAGG + Intergenic
1201009065 Y:9532367-9532389 CATAGGAAAATGTTGAGGAAAGG + Intergenic
1201331920 Y:12833166-12833188 CATTGGTATTTTCTTAGGATTGG + Intronic
1201932713 Y:19370713-19370735 CATAGGTAAATGAGTGTGATGGG + Intergenic