ID: 1085491407

View in Genome Browser
Species Human (GRCh38)
Location 11:76921853-76921875
Sequence TGCTATCTTCAAATATCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 2, 2: 6, 3: 71, 4: 437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085491407 Original CRISPR TGCTATCTTCAAATATCTGA AGG (reversed) Intronic
901120592 1:6889828-6889850 TGTTATTTTCATAAATCTGAAGG + Intronic
901420150 1:9145252-9145274 GGCTATGTTGAAATATGTGAGGG - Intergenic
905116809 1:35648600-35648622 TGCCACCTTCAAATATGTGAAGG + Intergenic
905331769 1:37208027-37208049 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
906087146 1:43145520-43145542 TGCTCTCATCAAAGCTCTGAGGG + Intronic
906402041 1:45511782-45511804 TGCTGTCTTCAGAGCTCTGAAGG - Exonic
906873062 1:49505526-49505548 TGATATATTCAAAGGTCTGAAGG - Intronic
907353173 1:53850223-53850245 AGCTGTCTTCAAACATCTGAAGG + Intergenic
907356539 1:53879618-53879640 TGTCATCTTCAGATATCCGAAGG + Intronic
908059966 1:60337113-60337135 TGCTATCTTCAAGCATCTGTGGG - Intergenic
908276643 1:62480058-62480080 TGTTATCTTCAAATATTTAAAGG - Intronic
908290929 1:62666265-62666287 TGAAATCTTCAATTAACTGATGG - Intronic
908315280 1:62926624-62926646 AACTATCTTCAAATATGTGCAGG + Intergenic
908670032 1:66535601-66535623 GGCTATCTTCTAAAATCTGTGGG - Intronic
909090167 1:71215917-71215939 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
909388246 1:75085681-75085703 AGCAATCTTCAAAGATCTGAAGG - Intergenic
909673057 1:78210542-78210564 TGCTATTTTAAAACCTCTGAGGG + Intergenic
909766862 1:79367141-79367163 TGCTCTCTTCAAATATTCAAAGG - Intergenic
909886289 1:80946145-80946167 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
909950916 1:81719505-81719527 TGCTATTTTTAAATATTTGTTGG + Intronic
909954303 1:81758883-81758905 ACCTATCTTCAAATATTTGAAGG - Intronic
910004302 1:82377269-82377291 CACTAGCTTCAAATGTCTGACGG + Intergenic
910123561 1:83816528-83816550 TGTAATCTTCAAATATGTCAAGG - Intergenic
910911351 1:92237618-92237640 TGCTCTCTTCAAAGCTCAGATGG + Intronic
910934092 1:92473095-92473117 TGCAATCTTCAAATTTCACACGG + Intergenic
911137741 1:94459227-94459249 AACTATCTTCAAATATATGTGGG - Intronic
911146442 1:94556851-94556873 TACTATCTTCAAATATTTTCTGG + Intergenic
911678104 1:100682446-100682468 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
911932403 1:103922090-103922112 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
912163593 1:107015542-107015564 TCCAATCTCCAAATAACTGAAGG + Intergenic
912452110 1:109773579-109773601 TACCATCTCTAAATATCTGAAGG - Intronic
913355025 1:117911051-117911073 GTCCATCTTCAAATATCTGAAGG - Intronic
913694835 1:121314817-121314839 TGCTCTCTTCAAAGCTCAGATGG + Intronic
913973472 1:143434856-143434878 TACTAACTTCAATCATCTGAAGG - Intergenic
914067861 1:144260463-144260485 TACTAACTTCAATCATCTGAAGG - Intergenic
914111294 1:144705891-144705913 TACTAACTTCAATCATCTGAAGG + Intergenic
914142725 1:144965240-144965262 TGCTCTCTTCAAAGCTCAGATGG - Intronic
914343261 1:146777460-146777482 TGCAATCTTTGAAGATCTGAGGG - Intergenic
915381091 1:155441429-155441451 TTCTTTATTCAAATATCTGGTGG - Intronic
915767411 1:158377558-158377580 TCCTATTTTCACATATCAGAAGG + Intergenic
915785807 1:158610405-158610427 TGCTATCTTCAAAAATTTTCAGG - Intergenic
915812405 1:158928010-158928032 TTTTATCCTCAAATGTCTGATGG - Intergenic
916304242 1:163311210-163311232 TGCTCTCTTTAATTATATGAAGG - Intronic
916447421 1:164886325-164886347 TGCTACCTTCAAATACCTAAAGG + Intronic
916814813 1:168341506-168341528 AGCTATATTCAAACATGTGAAGG - Intergenic
917015772 1:170529887-170529909 TCTTGTCTTCAAATATGTGAAGG - Intergenic
918116270 1:181500670-181500692 AGCTGCTTTCAAATATCTGAAGG - Intronic
918222697 1:182450355-182450377 TACTATCCTCAAAGATCTGGTGG - Intronic
918301597 1:183209017-183209039 TGCTATATTCATATAACTGTAGG + Intronic
918545097 1:185673248-185673270 AGCTTTCTTGAAATATATGATGG - Intergenic
919545482 1:198912312-198912334 TGTAATCTTAAAATATCTTATGG - Intergenic
919733964 1:200933083-200933105 TAGTATTTTAAAATATCTGATGG + Intergenic
919966672 1:202533621-202533643 TGCTATCTTCAAAAATATCAAGG - Intronic
920482164 1:206333200-206333222 TGCTCTCTTCAAAGCTCAGATGG + Intronic
920636374 1:207708364-207708386 TGGATTCTTCAAATATCAGAAGG - Intronic
922365261 1:224857373-224857395 AGCTTTCTTAAAATATTTGAAGG + Intergenic
922848204 1:228707408-228707430 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1063554279 10:7063425-7063447 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1063807995 10:9669586-9669608 TATTATCTTCAAATATGTGTAGG - Intergenic
1063886313 10:10583101-10583123 AGCTGTCTTCAAATATTCGAAGG + Intergenic
1064434486 10:15299346-15299368 TGCCAGCTTCAAAGATCTGTTGG + Intronic
1064633529 10:17341384-17341406 AGCTCTCTTCAAATATTTTAAGG + Intronic
1066197975 10:33119953-33119975 CGACATCTTCAAATATGTGAAGG + Intergenic
1066818436 10:39451876-39451898 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1067215251 10:44296136-44296158 TCCTATCTTCTCATATCAGATGG - Intergenic
1067240527 10:44488208-44488230 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1067785823 10:49246225-49246247 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1068642688 10:59427560-59427582 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1068817838 10:61337503-61337525 AGCTATCTTCAAATACCTGAAGG - Intergenic
1069756648 10:70777713-70777735 TGCTGTTTTCAAATCTCTGATGG - Intronic
1074023114 10:109605536-109605558 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1075841903 10:125511961-125511983 AGATATTTTCAAACATCTGAGGG - Intergenic
1077381347 11:2240439-2240461 TGCTATAATGAAATACCTGAGGG + Intergenic
1078370643 11:10741884-10741906 TACCATTTTCAAACATCTGAAGG + Intergenic
1078538155 11:12191919-12191941 AGCTGTGTTCAAAGATCTGAGGG + Intronic
1078711765 11:13799227-13799249 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1079318862 11:19433128-19433150 TTCTGTCTTCAAATGCCTGAAGG + Intronic
1079570545 11:21938189-21938211 TGCTAGCTTCAAGTAACTGAAGG - Intergenic
1080180159 11:29416214-29416236 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1080362368 11:31530710-31530732 AGCTGTCTTCAAATATCTGTTGG - Intronic
1082137583 11:48567091-48567113 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1082700291 11:56421416-56421438 TGCTATCTTCAAATCTCCGTAGG + Intergenic
1082933439 11:58632646-58632668 TCCTATCTTCAAGGAACTGAAGG + Intergenic
1084382674 11:68823385-68823407 TTCTCTCCTCAAATATATGATGG + Intronic
1085491407 11:76921853-76921875 TGCTATCTTCAAATATCTGAAGG - Intronic
1085879436 11:80448461-80448483 TGATATCTTCAAAATTCTGAAGG - Intergenic
1086221167 11:84445431-84445453 TAATATCTTCAAAGCTCTGAGGG - Intronic
1086910305 11:92464356-92464378 TACCATCTTCAAATATCTGAAGG + Intronic
1087631242 11:100653108-100653130 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1087748233 11:101974376-101974398 AGCTATGTACAAATATTTGAAGG + Intronic
1087863129 11:103188976-103188998 TGTTATCTTCATAAATTTGATGG - Intronic
1087883165 11:103443867-103443889 TGCTATCTCAAAATTTCTCAAGG - Intronic
1088094937 11:106087895-106087917 TGCTGTCTTCAAATAGTTTAAGG + Intronic
1088645899 11:111916163-111916185 GGTTATCTTTAAATATCAGAAGG - Intronic
1088737387 11:112738988-112739010 TGCTATGTTCATCTGTCTGATGG - Intergenic
1089608419 11:119655640-119655662 AGCCATCTTCCAATATTTGAAGG + Intronic
1089732995 11:120531095-120531117 AGCTGTCTCCAAATATCTAAAGG - Intronic
1090085525 11:123646998-123647020 ATCTGTCTTCAAATATTTGAAGG + Intronic
1090796110 11:130136797-130136819 TGCTATCCCCAAATCTCTGTGGG + Intronic
1090880306 11:130826901-130826923 AGCTATCTTCAAAGATCTGAAGG + Intergenic
1091728514 12:2862902-2862924 TGCTATTTTCATCTCTCTGAAGG + Intronic
1092612907 12:10190217-10190239 TGCCATCTTAAAACTTCTGAGGG - Exonic
1092628139 12:10349834-10349856 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1092685727 12:11043263-11043285 TTCTATATTCAGATTTCTGAGGG - Intronic
1092758717 12:11789724-11789746 TGCTACCTTCAAAATTCTGGGGG - Intronic
1093310750 12:17580174-17580196 TGTTGTCTTCAAATATTTAAAGG + Intergenic
1093733640 12:22594130-22594152 AGCTATCTTCAGATATTTGAAGG - Intergenic
1093860567 12:24161330-24161352 AGCTATCTTCAAATATCTGATGG - Intergenic
1094287113 12:28808036-28808058 TGCTATGTTCAGCTATCCGATGG - Intergenic
1095397238 12:41774991-41775013 AGCTGTCTCCAAATATTTGAAGG - Intergenic
1095427565 12:42093513-42093535 TGCTGTGTTTTAATATCTGATGG - Intronic
1096819857 12:54225504-54225526 TGCTATCTTCAAAGAAGAGATGG - Intergenic
1097000892 12:55875547-55875569 TGATATCTTTAAAGGTCTGAAGG - Intergenic
1097392523 12:59033094-59033116 TGCTGTCTTAAAATGTTTGAAGG - Intergenic
1097528364 12:60766849-60766871 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1098550739 12:71758400-71758422 AGCTATCTTCAACTATCAGAAGG - Intronic
1098951913 12:76648473-76648495 AGCTGTTTTCAAATATTTGAAGG - Intergenic
1099198263 12:79645508-79645530 CTCTATTTACAAATATCTGAGGG + Intronic
1099492965 12:83308396-83308418 TGTAATCTTCAAACATCTGAAGG - Intergenic
1100462305 12:94812359-94812381 TGCTATCTTCAAAGCTGTGATGG - Intergenic
1100952997 12:99873533-99873555 GGCTATCTTTAAATATTTGAAGG - Intronic
1101039983 12:100745992-100746014 TGATATCTTCAAAGTGCTGAAGG + Intronic
1101042648 12:100772225-100772247 AGCTGTCTTCAGATATGTGAAGG + Intronic
1101048921 12:100840655-100840677 TGCTGCCTTCACATGTCTGAGGG - Intronic
1101262898 12:103051027-103051049 TGTTCTTTTCAAATCTCTGAAGG - Intergenic
1101703702 12:107199780-107199802 AGCTAACTTCAAATTTTTGAAGG + Intergenic
1105256852 13:18749398-18749420 TTTTATATGCAAATATCTGAAGG - Intergenic
1107741611 13:43456280-43456302 GGATATCCTCAAATATCTGATGG + Intronic
1108137221 13:47378737-47378759 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1108761785 13:53575995-53576017 TACTATCTTCAAGTATATGAGGG + Intergenic
1109224545 13:59676428-59676450 ATCTGTCTTCAAATATTTGAAGG - Intronic
1109868576 13:68300870-68300892 AGCTATTTTTAAATATCTGAGGG - Intergenic
1109876668 13:68414483-68414505 TATAATCTTCAAATATGTGAAGG - Intergenic
1110294469 13:73846488-73846510 TTCGTTCTCCAAATATCTGAAGG + Intronic
1111441722 13:88290474-88290496 TGATATGTTCAAAGAGCTGAAGG - Intergenic
1111668647 13:91301145-91301167 AAATGTCTTCAAATATCTGATGG - Intergenic
1111809029 13:93074718-93074740 AGCCATCTTCAAATATTTAAAGG - Intergenic
1111829653 13:93311337-93311359 AGCTATATTCAAATAGCTCAAGG - Intronic
1112623041 13:101071562-101071584 TACTCTCTTCAAATTTATGAAGG - Intronic
1112771202 13:102796858-102796880 TGCAAGCTACAAAAATCTGAAGG - Exonic
1113529820 13:111014793-111014815 TTCTCTCTGCAAATATCTAAAGG + Intergenic
1114035185 14:18618445-18618467 TGATCTTTTCAAATATCTAATGG - Intergenic
1114123460 14:19696570-19696592 TGATCTTTTCAAATATCTAATGG + Intergenic
1114357912 14:21934025-21934047 TGCTGTCTTAAAATATTTCAAGG + Intergenic
1115406063 14:33018228-33018250 TGCTGTCTTAAAACATTTGAAGG + Intronic
1115768020 14:36643842-36643864 AGCTGTCCTCAAATATTTGAAGG - Intergenic
1115964155 14:38868148-38868170 TTCTATATGCACATATCTGAAGG + Intergenic
1116055953 14:39864069-39864091 TGCTATCTTCAAATATTTGAAGG + Intergenic
1116200172 14:41783409-41783431 TTGTATCTTCAGTTATCTGATGG + Intronic
1117207542 14:53459618-53459640 AGCTGTTTTCAAACATCTGATGG + Intergenic
1117486881 14:56206615-56206637 TGTTATTTTAAAACATCTGAAGG - Intronic
1118100627 14:62597290-62597312 TGATATATTCAAAAAGCTGAAGG + Intergenic
1118118714 14:62811253-62811275 TGTTTTCTTAAAATATCTGATGG + Intronic
1118264394 14:64280636-64280658 TGGGAACTTCAAATGTCTGAAGG - Intronic
1118446899 14:65860361-65860383 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1119885241 14:78134864-78134886 CTCTTTCTTCAAATATCTGCTGG + Intergenic
1121449371 14:93997723-93997745 TGCTGGCTTCAAATAAATGATGG - Intergenic
1122196205 14:100087972-100087994 TGCGATTTTCAAGTCTCTGAAGG + Intronic
1124149574 15:27165488-27165510 AGCAATCTTCAAATATTTGAAGG - Intronic
1124451865 15:29801017-29801039 TATTATCTTAAAATATCTAATGG + Intronic
1126167274 15:45664377-45664399 AGCCATCTTCAAATAGCTGAAGG - Intronic
1126224173 15:46250798-46250820 TGATCTCTTCAATTTTCTGAAGG - Intergenic
1126497900 15:49312754-49312776 AGCTGTCTTCAGATATCTGAAGG + Intronic
1126610683 15:50526515-50526537 TGCCATTTCCAAATATTTGAAGG + Intronic
1126646363 15:50878913-50878935 TGTAGTCTTCAAATATCTGAAGG + Intergenic
1126677553 15:51173590-51173612 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1126720710 15:51575826-51575848 TACTGTCTTCAAAGATCTGTAGG - Intronic
1127376942 15:58393675-58393697 GGCTGCCTTCAAATATCTGCAGG + Intronic
1127820646 15:62652561-62652583 TATTTTCTTCAAATATTTGAAGG - Intronic
1128827139 15:70729742-70729764 TGCTCTCTTCAAAGCTCAGATGG - Intronic
1128942252 15:71798541-71798563 TGCTCTCTTCAAAGCTCCGATGG + Intronic
1129027984 15:72597262-72597284 CTCTAGCTTCAAATATTTGAAGG + Exonic
1129812583 15:78522934-78522956 TACTATCCTCAAAAATCTGGAGG + Intronic
1130055752 15:80523962-80523984 TTCTGTCTTCAAGTATTTGAGGG + Intronic
1131327950 15:91467263-91467285 TGCAATCTTTAAAAATCTTATGG + Intergenic
1135017955 16:18939731-18939753 TGCTACCATCAGATAACTGATGG + Intergenic
1135657069 16:24259643-24259665 AGCTGTCTGCAAATATCTGAAGG + Intronic
1136646494 16:31623370-31623392 TGATAACTGCAAATATCTAAAGG - Intergenic
1137013047 16:35343689-35343711 TTCTGTCTACAAATATCTAATGG - Intergenic
1138209189 16:55148829-55148851 AGCTGTCTTCATATGTCTGAAGG - Intergenic
1138964768 16:62070977-62070999 TGCTATGTTCTAATATCACAGGG + Intergenic
1139052914 16:63147758-63147780 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1139196932 16:64930406-64930428 TTCTATCTTTAATTATTTGAGGG - Intergenic
1139758535 16:69165334-69165356 TGCTGTACTCAAATACCTGAGGG - Exonic
1139990727 16:70937867-70937889 TGCAATCTTTGAAGATCTGAGGG + Intronic
1140253127 16:73312253-73312275 AGCTATCTTTAAATATTTGGAGG + Intergenic
1146256452 17:31393669-31393691 TGCTATTTTCAAATATTTAAAGG - Intronic
1146471607 17:33129407-33129429 TGCTATCTGCAAATATTTGAAGG + Intronic
1146926330 17:36748307-36748329 TTCTATCTTCAAACACCTGAAGG + Intergenic
1147263463 17:39222126-39222148 TGGTGTCTTCAAATATTTGAAGG - Intronic
1148855909 17:50579246-50579268 AGCTGTCTTCAAATATTTGAAGG + Intronic
1148983156 17:51596818-51596840 TGTTGTCTTCTAATATCTCAAGG + Intergenic
1156047652 18:32895450-32895472 TGCTATGTTCAAATGTCTTCAGG - Intergenic
1156161422 18:34362750-34362772 TGCCTCCTTCAAATATCTGGTGG - Intergenic
1156232086 18:35163623-35163645 TGCTAACTTCTAATATTTAAAGG + Intergenic
1156294642 18:35778517-35778539 GTCTTTCTTCAAATATCTGGTGG + Intergenic
1156321398 18:36027853-36027875 TGATATCTTCAAGTATCCTATGG + Intronic
1156919994 18:42510198-42510220 AGCAATCTTCATATAGCTGAAGG + Intergenic
1157163869 18:45339999-45340021 GGCTATGCTCTAATATCTGATGG - Intronic
1157364052 18:47047323-47047345 TGCTATCTTCAAATGTGTAGAGG - Intronic
1157703001 18:49776456-49776478 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1158078290 18:53558080-53558102 TGTTGTCTTCTAAAATCTGACGG - Intergenic
1158326430 18:56318462-56318484 AGCAGTCTTAAAATATCTGAGGG - Intergenic
1158858103 18:61564159-61564181 TGCTCTCTTCAAATCTCAGTTGG + Intergenic
1159357902 18:67359725-67359747 TGCCAGCATCAAAGATCTGATGG + Intergenic
1159608785 18:70503348-70503370 TAATATCTTCAAATTTCTCACGG - Intergenic
1159791786 18:72790759-72790781 AGCAATCTTCAAACATTTGAAGG - Intronic
1164183046 19:22836430-22836452 TGCAATCCTTAAATATCTTATGG - Intergenic
1167126201 19:47550630-47550652 AGACGTCTTCAAATATCTGAAGG + Intronic
1168461801 19:56565943-56565965 TTCTATCTTCAGTTCTCTGATGG + Intergenic
925473760 2:4190308-4190330 GACTTCCTTCAAATATCTGAAGG - Intergenic
925892061 2:8442292-8442314 TATTTTCTTCAAATACCTGATGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927020157 2:19008466-19008488 TTATATCTTCAAATCTCTAAAGG + Intergenic
927412464 2:22843091-22843113 TGATATCCTCAAATATCACAGGG - Intergenic
927883083 2:26702438-26702460 TCCCAACTTCAAATATCTGCTGG + Intronic
927982929 2:27386220-27386242 TGATATCATCAAAGATCAGAAGG - Exonic
928261471 2:29771483-29771505 TGATGTCTTCCAAAATCTGAAGG + Intronic
928708833 2:33981737-33981759 TCCTACCTTAAATTATCTGATGG - Intergenic
929133956 2:38604692-38604714 TGGTATCTTCAGCTTTCTGAAGG - Intergenic
929207237 2:39310878-39310900 TGATATTTTCATGTATCTGATGG + Intronic
930255143 2:49082103-49082125 TGCTCTCTTCAAAGCTCAGATGG - Intronic
930277505 2:49330754-49330776 TGCTTTCCTCAAATTTCTGTTGG - Intergenic
930445703 2:51469098-51469120 TGCTATATTGAAATGTCTGTAGG + Intergenic
930480265 2:51939974-51939996 TCCTATCTTAGAATATTTGATGG - Intergenic
931011107 2:57915429-57915451 TGATTTCTTTAAATATGTGATGG - Intronic
931068800 2:58620882-58620904 CCCTGTCTTCAAATATTTGAAGG + Intergenic
931303073 2:61000224-61000246 TGCTTTCCTTAAATATTTGAGGG - Intronic
931387155 2:61808127-61808149 TGCTGTCTGCCAATCTCTGAGGG + Intergenic
931704421 2:64935487-64935509 AGCTGTCTCCAAATATCTGAGGG - Intergenic
931935932 2:67196304-67196326 TGTTTTGTTCAAATATCTGTAGG + Intergenic
932474705 2:71995662-71995684 CGTTATCTCCAAGTATCTGAAGG + Intergenic
932524359 2:72447423-72447445 TACTACCTTCATATATTTGAAGG - Intronic
932531049 2:72533026-72533048 TGAAATAGTCAAATATCTGAAGG + Intronic
932638800 2:73420119-73420141 TGCTATGGTCAAATATTTGAAGG + Intronic
933178917 2:79208033-79208055 TCTTATCTTGAAATATGTGAGGG - Intronic
933296263 2:80494585-80494607 TGCTATTTTCAAATATTTATTGG + Intronic
934178168 2:89595822-89595844 TACTAACTTCAATCATCTGAAGG - Intergenic
934288467 2:91670114-91670136 TACTAACTTCAATCATCTGAAGG - Intergenic
934701138 2:96441193-96441215 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
935726199 2:106026174-106026196 AGCTGCCTTCAAATATTTGACGG + Intergenic
935732733 2:106077758-106077780 TGTCATCTTCAAATTTCTGGAGG - Exonic
935861056 2:107330002-107330024 TGGTGACTTCAATTATCTGATGG + Intergenic
937124133 2:119462509-119462531 TGCACTCTCCACATATCTGATGG + Intronic
937605184 2:123791921-123791943 TGCTATCTTGCAATGGCTGATGG - Intergenic
938276062 2:130024432-130024454 TGATCTTTTCAAATATCTAATGG + Intergenic
938327020 2:130415175-130415197 TGATCTTTTCAAATATCTAATGG + Intergenic
938362921 2:130706301-130706323 TGGTCTTTTCAAATATCTAATGG - Intergenic
939974697 2:148703997-148704019 GTCTATCTTCAATTTTCTGAGGG - Intronic
940610457 2:155984343-155984365 TGGTATTTTCAAAGATCTTATGG + Intergenic
940864172 2:158800659-158800681 AGCCATCTTCAAAGATCTGAAGG - Intronic
941121534 2:161536271-161536293 TGCTCTCTTCAAAGCTCAGATGG - Intronic
942148741 2:173053676-173053698 TTCTATCTTCAAATAAATGTGGG + Intergenic
942373611 2:175312389-175312411 TGCTGCCTTCAAGTATTTGAAGG + Intergenic
942886732 2:180934532-180934554 AGCTGTCTTCAAATATCTAAAGG - Intergenic
943873974 2:193037898-193037920 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
945422102 2:209651077-209651099 TGGCATCTTCATATATGTGAAGG - Intronic
945423467 2:209668391-209668413 TGCTATTTGCAAATTTCTCAAGG + Intronic
945967042 2:216199194-216199216 TGCTAACTTTAAATAACTTATGG - Intronic
946067828 2:217004647-217004669 TGATATCTTCAAATAATTCAAGG - Intergenic
946188548 2:217995319-217995341 TCCTATCCTCAAATATATGAAGG + Intronic
946508112 2:220323299-220323321 TGCCTTCTTCAAATGTATGAAGG - Intergenic
946543253 2:220708761-220708783 TGCTACCTTCAAAACTCTTAGGG - Intergenic
947042215 2:225936100-225936122 TCCTGTCTTCAAATTTCTGCTGG - Intergenic
948636621 2:239342115-239342137 TGCTATCATAAAATACCTTAGGG - Intronic
1169973303 20:11295220-11295242 AACTAACTCCAAATATCTGAAGG - Intergenic
1170097490 20:12662760-12662782 TGCTGTCTTCAAAGCTCAGATGG - Intergenic
1171357289 20:24557824-24557846 TGCTCTCTTCAAAGCTCAGATGG + Intronic
1171842747 20:30235340-30235362 AGTTGTTTTCAAATATCTGAGGG - Intergenic
1172507001 20:35470415-35470437 AGCTGCCTTCACATATCTGAAGG + Intronic
1172584813 20:36075622-36075644 AGCAATCTTGGAATATCTGAAGG + Intergenic
1173764322 20:45593372-45593394 TGATATCTTCAACTTGCTGATGG - Intergenic
1174994563 20:55551454-55551476 TTCTATCTCCAACTATCTCAGGG + Intergenic
1176842846 21:13854448-13854470 TTCTATATGCAAATATCTGAAGG - Intergenic
1177123147 21:17163633-17163655 TGCTCTCTTCAAAGCTCGGATGG - Intergenic
1177958671 21:27634177-27634199 TGCCATGTTCAAAAATCTCAGGG + Intergenic
1178614594 21:34120483-34120505 AGCTAACTTCAAATATTTGCAGG - Intronic
1180459304 22:15545491-15545513 TGATCTTTTCAAATATCTAATGG - Intergenic
1182594916 22:31411877-31411899 AGCGTTCTTCAAATTTCTGAGGG - Intronic
1183126652 22:35788593-35788615 AGTTATCTTCAAAATTCTGAAGG - Intronic
1183227499 22:36560505-36560527 CTCTGTCTTCAAATATCTGAGGG + Intergenic
1184936576 22:47728369-47728391 TTCTTTTTTCAAATTTCTGAGGG - Intergenic
949181612 3:1137982-1138004 AGTCATCTTCAAATATTTGAAGG - Intronic
949276673 3:2291454-2291476 TATTTTCTTCAAATATCTAAAGG - Intronic
949871909 3:8596281-8596303 AGCTGCTTTCAAATATCTGAAGG + Intergenic
950319089 3:12033272-12033294 TGCTCTCTTCAAAGCTCAGATGG + Intronic
951167386 3:19498972-19498994 TGCTCTCTTCAAACCTCAGATGG + Intronic
951527141 3:23664382-23664404 TGCCATCTTCCAATACCTGAAGG - Intergenic
951547872 3:23846915-23846937 TGCTATCTTGAAATATTCTAAGG + Intronic
951592357 3:24280187-24280209 TGCTCTCTTCAAATTTCAGATGG - Intronic
951813094 3:26723090-26723112 TGATAACTTCAAAAATCTTAAGG + Intergenic
951941663 3:28086302-28086324 TGCTTTCAACAAATATCTGAAGG - Intergenic
952174403 3:30845994-30846016 AGCTATCTTTAAGTACCTGAGGG + Intronic
952635660 3:35527091-35527113 TTCTCTCTTCAAATCTATGAAGG - Intergenic
954542999 3:51408071-51408093 TGCTTTCATCAAATGCCTGAAGG + Intronic
954871444 3:53770417-53770439 TGCTCTCTTCAGAGTTCTGAAGG - Exonic
955085574 3:55699316-55699338 TTTTATCTTAAAATATCTAAAGG + Intronic
955543527 3:60002966-60002988 TCCTATTTTCCAATCTCTGAGGG - Intronic
955659288 3:61279172-61279194 TGCTATAATGAAATATCTGAGGG - Intergenic
955983714 3:64551865-64551887 AGCCCTCTTCAAATAGCTGAAGG - Intronic
956058839 3:65329427-65329449 AGCTATCTTCACATGTCTGTCGG + Intergenic
957422744 3:79992925-79992947 TCCTATCTTTAAAAATCTTAAGG + Intergenic
957830748 3:85515309-85515331 TGTTATCTTCGAAAATCTAATGG - Intronic
957963206 3:87287712-87287734 AGCAATATTCAAATATATGATGG + Intergenic
958579332 3:95997351-95997373 TGCTATATATAAATTTCTGAAGG + Intergenic
959770418 3:110088782-110088804 TTCTATTTTCATATATCTTATGG + Intergenic
960313242 3:116142636-116142658 AGCTGTCTTCAACTATCTGAAGG - Intronic
960440132 3:117676636-117676658 TGGTTTCTTCAAATGTCTGCTGG - Intergenic
960539355 3:118846802-118846824 TCCTATATTCAAATATATAATGG - Intergenic
961112579 3:124297620-124297642 GGCTATCTTCAAATATTTAAAGG + Intronic
962356288 3:134697147-134697169 AGCTATCTTCAAATGTTTGAAGG + Intronic
962483854 3:135822589-135822611 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
964658075 3:159090319-159090341 TGCTCTCTTCAAAGCTCAGATGG + Intronic
964704085 3:159600012-159600034 TGATATATTCAAAGAACTGAAGG - Intronic
964994228 3:162855036-162855058 TGCTATATTCAAACTGCTGAAGG + Intergenic
965487860 3:169300593-169300615 GACTAGCTTCAAATATCTGAAGG - Intronic
966103111 3:176299820-176299842 GGCTGTCTTCAAATATTTGAAGG + Intergenic
966236791 3:177710448-177710470 TACCATCTTGAAATTTCTGAGGG + Intergenic
967210792 3:187166694-187166716 TACCATCTTCAGATATCTGAAGG + Intronic
967215201 3:187203778-187203800 TCCTGTCTTCCAATAGCTGAAGG + Intergenic
967447851 3:189587751-189587773 TGCTGTCTTTAAATATTTTAAGG + Intergenic
967978978 3:195054154-195054176 GGCTTTCCTCAAATGTCTGATGG + Intergenic
969831081 4:9797574-9797596 TACTAACTTCAATCATCTGAAGG + Intronic
971284650 4:25276104-25276126 AGATATTTTCAAATACCTGAAGG + Intronic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
971726759 4:30324414-30324436 TGCTATGTTTTAATATCAGAAGG + Intergenic
971754927 4:30695299-30695321 TGATATCTTCAATTGTTTGATGG - Intergenic
972106898 4:35499462-35499484 TTTTATCTTTAAATTTCTGAAGG - Intergenic
973023079 4:45227789-45227811 TGGTATCTTCAAACATGAGAGGG + Intergenic
973597264 4:52504866-52504888 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
974160944 4:58138280-58138302 TGCTAACTTTAGATCTCTGAAGG - Intergenic
974591485 4:63953592-63953614 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
974758250 4:66241367-66241389 TGATGTTTTCAAATATCAGAGGG - Intergenic
974874475 4:67686257-67686279 TGCCATCTTCAAATGTTTGGAGG - Intronic
975363260 4:73497143-73497165 AGTTTTCTTCAAATATTTGATGG - Intronic
975811694 4:78176514-78176536 GGCTGTCTTCACATATTTGAAGG - Intronic
975980646 4:80154831-80154853 TGCTAACTGCACATAGCTGATGG - Intergenic
976559660 4:86487006-86487028 TGATATTTTCAAATATAAGACGG - Intronic
976945816 4:90766192-90766214 TGCTATGTTCAAATATAAGTAGG - Intronic
977120720 4:93097307-93097329 TTTTGTCTTCAAATATTTGATGG - Intronic
977175344 4:93813599-93813621 TTCTATATTTAAATATTTGACGG - Intergenic
977541183 4:98320521-98320543 TGCTCTCTTCAAAGCTCAGATGG - Intronic
977952669 4:102992321-102992343 TGCTAGCTTCAAATATAAGTAGG + Intronic
977961928 4:103096385-103096407 TGCTGTCTTCAAGTTCCTGAAGG - Intronic
978937574 4:114396747-114396769 TGATCTCTTCTAATGTCTGATGG - Intergenic
978997283 4:115172463-115172485 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
979293891 4:119008833-119008855 TGGCATCTTCTAATATTTGAAGG - Intronic
979425920 4:120566123-120566145 GGCTTTCTTCAAATAATTGATGG + Intergenic
980545313 4:134254080-134254102 TGCTATATTCAAAGTGCTGAAGG - Intergenic
980594781 4:134939649-134939671 AGCTCTCTTCAATTCTCTGAAGG + Intergenic
980846246 4:138328893-138328915 TGCTATTTTCAAATCTTTGAAGG + Intergenic
981032791 4:140142692-140142714 TGCTTTCTTAAAATATTTGAAGG - Intronic
981601790 4:146497430-146497452 GTCTGCCTTCAAATATCTGAAGG - Intronic
981947758 4:150368929-150368951 TGGAGTGTTCAAATATCTGATGG + Intronic
981991918 4:150931784-150931806 AGCTATATTCAAATATCTGGGGG + Intronic
983326616 4:166266014-166266036 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
983482559 4:168292733-168292755 AGCTATCTTCAAACATTTGCAGG + Intronic
983572330 4:169223642-169223664 TTCCATGTTCAAATATCTAAAGG + Intronic
986478362 5:8159151-8159173 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
989052116 5:37331794-37331816 TTCTTTCTTCAAATTTCTTAGGG - Exonic
989442131 5:41485468-41485490 TTCTTTCTTCAAATACATGAAGG - Intronic
989677116 5:43984956-43984978 TGCCACCATCAAAGATCTGAAGG - Intergenic
990309110 5:54520706-54520728 TGCTGTCTCCAAATGTCTGAAGG - Intronic
990616656 5:57515598-57515620 AACTACCTTCAAATATCTGAAGG - Intergenic
991492770 5:67199238-67199260 AGCTATTTTCAAATACTTGAAGG - Intergenic
992036032 5:72777312-72777334 TGCTATATTCAAAGTGCTGAAGG + Intergenic
992814997 5:80428085-80428107 TGCTCTCTTCAAATCTCAGTTGG - Intronic
994324204 5:98430169-98430191 TGGTATCCTCAATTATCTTAAGG + Intergenic
994949749 5:106446114-106446136 TGCTATTTTGAGATATTTGAGGG - Intergenic
995380239 5:111523521-111523543 TGCTCTTTTGAAATATTTGAAGG + Intergenic
995672726 5:114625259-114625281 TGGTATCTTCACAAAACTGATGG - Intergenic
996081289 5:119261072-119261094 TGTTATCTTCAACTATCTCTTGG - Intergenic
996098824 5:119427117-119427139 TGCTTTATTCACATATTTGAGGG - Intergenic
998184714 5:139969298-139969320 AGCTATCTTGAAATATCTATAGG + Intronic
998246978 5:140515539-140515561 TGCTCTCTTCAAAGCTCAGATGG - Intronic
998764000 5:145464487-145464509 GTCTGTCTTCAAATATCTGCAGG + Intergenic
999058725 5:148610277-148610299 TGCTCTCTTCAAAGCTCAGATGG - Intronic
999522192 5:152362239-152362261 TGCTAACTTCAAATACCTGAAGG + Intergenic
999653379 5:153789066-153789088 AATTGTCTTCAAATATCTGAAGG - Intronic
999830055 5:155310157-155310179 TGCCTTCTTTAAATATTTGAAGG + Intergenic
1003033342 6:2621647-2621669 TTCTATCTTAAAACATATGAAGG - Intergenic
1004021768 6:11782458-11782480 TCCTTTCTCCAAGTATCTGAGGG + Intronic
1004583049 6:16972982-16973004 AACTGTCTTCAAATACCTGAGGG + Intergenic
1005270966 6:24163310-24163332 TGCTATCCTCAAATATTTAAAGG - Intergenic
1005656433 6:27943375-27943397 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1005904328 6:30247972-30247994 TGCTCTCTTCAAAGCTCAGACGG - Intergenic
1005928190 6:30462183-30462205 TGCTCAGGTCAAATATCTGAAGG - Intergenic
1006171251 6:32094660-32094682 TGGTGTCTCCAAATACCTGAAGG + Intronic
1006496059 6:34424626-34424648 AACTATCTTCAAATAGCTGAAGG + Intronic
1006595613 6:35190990-35191012 TGCTGCCCTCAAATATCTGAAGG + Intergenic
1006724675 6:36189131-36189153 TACTTTCTTCATATATCTGTTGG + Intergenic
1007855753 6:44854845-44854867 AGCTATCTTCAAATACCTGAAGG + Intronic
1009309181 6:62127706-62127728 TACTGTCTTCAATTATTTGAAGG + Intronic
1009633551 6:66233171-66233193 AGCAATTTTCAAATATGTGATGG + Intergenic
1010513947 6:76751031-76751053 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1010737541 6:79460133-79460155 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1011004833 6:82632853-82632875 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1011702135 6:89965656-89965678 AGATGTCTTCAAATATGTGATGG - Intronic
1012089871 6:94877761-94877783 TGCTATCTTCAGATATATTTTGG + Intergenic
1012800633 6:103822550-103822572 TGCTATCTTCCATTTTGTGATGG - Intergenic
1012944840 6:105454366-105454388 AGCTATCTTAAAATATTTAAAGG - Intergenic
1013146313 6:107397071-107397093 TTCTATTTTCAAAAATCTCAAGG + Intronic
1013160569 6:107540120-107540142 TACTACCTTAAAATATCTCAAGG - Intronic
1013889456 6:115009064-115009086 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1014066668 6:117134986-117135008 TATTATCTTCAGACATCTGAAGG - Intergenic
1014145741 6:117996404-117996426 TGCTCTCTTCAAAGCTCAGACGG - Intronic
1014178941 6:118362587-118362609 TGCTAGCTTCAATTAGCTGTAGG - Intergenic
1014969364 6:127794967-127794989 TTCTTTCTGCAAATATCTGTTGG - Intronic
1015153804 6:130067569-130067591 TGGTATTTTCAGATAGCTGAAGG + Intronic
1015776413 6:136819394-136819416 CACTATCTTCAAATATATGATGG - Intergenic
1016328649 6:142932625-142932647 TGCTATCTTTAAATAATTGTAGG + Intronic
1016571611 6:145519701-145519723 TACAATCTTCAAAAGTCTGAAGG - Intronic
1018347035 6:162910497-162910519 ATCTATGTTCAACTATCTGAAGG - Intronic
1018398253 6:163397922-163397944 GGCTATCCCCAAATATTTGATGG - Intergenic
1018666466 6:166142967-166142989 TGTTATCTTCATATAGCTGTTGG - Intergenic
1019399363 7:843038-843060 TGGTATCTGCATATATCTGGAGG + Intronic
1021394214 7:20126942-20126964 TGTTGTCTCCAAATGTCTGAAGG + Intergenic
1021509017 7:21415246-21415268 GTCTATCTTGAAATATTTGAGGG - Intergenic
1022820306 7:33953336-33953358 TTCATTCTTCAAATAACTGAGGG - Intronic
1023726948 7:43152678-43152700 AGCTTTCTTCAACTATCTGGTGG + Intronic
1024972625 7:55084760-55084782 AGCTGTCTTCAAATATTTAAAGG + Intronic
1025609046 7:63060830-63060852 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1025948627 7:66124751-66124773 TGCTATCTACAACTCTCTAATGG - Intronic
1026684350 7:72495380-72495402 TGCTATTTTTAACTAACTGAAGG - Intergenic
1027223505 7:76229458-76229480 GCCTAGCTTCAAATATATGAAGG - Intronic
1027712329 7:81620747-81620769 TGCCATCTTAATATATATGATGG - Intergenic
1027874287 7:83749267-83749289 TGCTCTCTTCAAACCTCAGATGG + Intergenic
1028137595 7:87238748-87238770 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1028355575 7:89902288-89902310 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1030306554 7:108025162-108025184 GGCTGTTTTCAAGTATCTGAAGG + Intronic
1030681457 7:112438782-112438804 TGCTATATTCCAAAAACTGAGGG - Intronic
1031063154 7:117074551-117074573 TGCAATTTACAAATATCTGTGGG + Intronic
1031100863 7:117478937-117478959 CGCCATCTTCAACTCTCTGAGGG - Intronic
1031436817 7:121742461-121742483 TGCTGTATTCCAATATTTGATGG + Intergenic
1031838804 7:126711852-126711874 TGCTCTCTTCAATTCTATGAAGG - Intronic
1032653032 7:133899553-133899575 AGCTATCTTCATATATTTCAAGG - Intronic
1033971281 7:147043493-147043515 TGTTATCTTTAAATTTCTAATGG + Intronic
1034860344 7:154589737-154589759 AGCTGTCTGCAAATATCTGAAGG - Intronic
1034938603 7:155215618-155215640 TGTTATCCTCAAACATCTGAGGG + Intergenic
1035884369 8:3276313-3276335 TGCTCTCTTCAAAGCTCAGATGG + Intronic
1035930984 8:3779493-3779515 TGATTTCATCAAATATGTGATGG + Intronic
1037634319 8:20687533-20687555 CGCTAGCTTCAAATATCTTAAGG + Intergenic
1038098164 8:24339764-24339786 TTCTTTCTTCAAGTATCTCATGG + Intronic
1038364552 8:26917975-26917997 TGCTATAAAGAAATATCTGAGGG + Intergenic
1038667379 8:29550864-29550886 TGCTAACTTCAACATTCTGAGGG - Intergenic
1038707235 8:29905945-29905967 TACTTTCTTCAAATATTTGAAGG + Intergenic
1039922396 8:41902751-41902773 AGCTCTCCTCAAATATTTGAAGG - Intergenic
1041048513 8:53909962-53909984 TGCTCTCTTCAACTATCTACTGG - Intronic
1041367448 8:57123695-57123717 TTCTGTCTTCAAATATCAGTTGG + Intergenic
1041416214 8:57611304-57611326 TGCCATATTCAAAGAGCTGAGGG + Intergenic
1041491922 8:58442615-58442637 TGCTTTCTTCTATTATGTGAGGG - Intronic
1042211466 8:66385493-66385515 TGCTCTGCTCAAATATTTGAAGG + Intergenic
1042402187 8:68362501-68362523 TGCTCTCTTCAAAGCTCAGATGG - Intronic
1042424865 8:68635867-68635889 GGCAACCTTCAAATATCTAAAGG - Intronic
1042587131 8:70353208-70353230 AGGTTTCTTCAAATATCTTAAGG - Intronic
1042694755 8:71544599-71544621 TGTAATCTTCAAATATTTCAAGG - Intronic
1044134063 8:88561949-88561971 TGATATCTTCAAGTAATTGAAGG - Intergenic
1044230297 8:89767804-89767826 AGCTATCTTCAAATATTGAAAGG - Intronic
1045355208 8:101381232-101381254 TGGTATCTTCAAAATACTGAAGG - Intergenic
1046185175 8:110704587-110704609 AGCACTCTTCAAATATTTGAAGG + Intergenic
1046967465 8:120183555-120183577 AGCTGTCTTCAAATATGTAAAGG - Intronic
1047246438 8:123149196-123149218 AGTCATCTTCAAACATCTGAAGG - Intronic
1047837726 8:128712471-128712493 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1050042018 9:1505859-1505881 AACAATCTTCAAATATTTGAAGG - Intergenic
1050299583 9:4243625-4243647 AGCCATTTTCAAATATGTGAAGG + Intronic
1050429251 9:5545073-5545095 AGTTATATTCAAATATCAGAAGG + Intronic
1051255052 9:15204599-15204621 TGCTAGCTTCTAAAATATGAAGG + Intronic
1052212831 9:25927674-25927696 TGTTATTTTCTAATATCTTAAGG - Intergenic
1052549163 9:29925830-29925852 GGCTGTCTTCAAATATGTGAAGG - Intergenic
1052732863 9:32310334-32310356 TGATTTATTCAAGTATCTGATGG + Intergenic
1053419174 9:37966139-37966161 TGATTTACTCAAATATCTGAGGG + Intronic
1054165234 9:61719326-61719348 AGTTGTTTTCAAATATCTGAGGG + Intergenic
1055277380 9:74634435-74634457 TGCTATCTGCAAAGATATGAGGG - Intronic
1055547523 9:77394886-77394908 AACTATCTTCAATTATATGAAGG - Intronic
1056325761 9:85477433-85477455 TGCCATCTACTAATATCTTATGG + Intergenic
1057607983 9:96515388-96515410 TGCTATTTTGAAATATGTTAAGG + Intronic
1058482673 9:105413038-105413060 TACTATATTCAAATATCTAAAGG + Intronic
1058812135 9:108650923-108650945 AGCTATCTACAAAAATATGAAGG + Intergenic
1058889387 9:109347949-109347971 TGTTATCTTCAAACATTTGAAGG - Intergenic
1060123101 9:121014422-121014444 AGCCATCTTCAAATATTTGAAGG - Intronic
1060686581 9:125619627-125619649 TGCTATGTTCGTATATATGAAGG - Intronic
1060696917 9:125717243-125717265 AGCCATCTTCAAATATCTAAAGG - Intergenic
1060700294 9:125745596-125745618 TTCTACCTACAAATAACTGAAGG - Intergenic
1060855529 9:126912445-126912467 TTCTTTCTACAAATATCTAATGG - Intergenic
1186327039 X:8490369-8490391 AGCTCTCTTCAAATATTTAAAGG - Intergenic
1186564843 X:10651515-10651537 GACTGTCTTCAAATATCTGTGGG - Intronic
1187070399 X:15881696-15881718 TGCTATATGCAAATTTCAGATGG - Intergenic
1188189237 X:27153980-27154002 TGCCATATTCAGATACCTGATGG - Intergenic
1188249904 X:27880009-27880031 TGCTGTCTTCACATAGCAGAAGG + Intergenic
1189159741 X:38800023-38800045 ATCTACCTTCAAACATCTGATGG + Intergenic
1189367579 X:40400862-40400884 GGTCATCTTCAAACATCTGAAGG - Intergenic
1189549961 X:42082757-42082779 TCCTATCTTCCAACTTCTGAGGG - Intergenic
1190480206 X:50869995-50870017 TGCTGTGTTCAAATATGTGAAGG + Intergenic
1191163512 X:57361940-57361962 TGCTATCTTCAAAATAATGAAGG - Intronic
1192256408 X:69463930-69463952 TGCTCTCTTCAAAGCTCAGACGG + Intergenic
1192774966 X:74234274-74234296 TCCTATAATCAAATTTCTGATGG + Intergenic
1193233915 X:79083589-79083611 ACACATCTTCAAATATCTGAAGG - Intergenic
1193829638 X:86274145-86274167 TCCAACCTTCAAATATCTGTAGG + Intronic
1194778564 X:97994977-97994999 TGTGATCTTAAAATATCTAAGGG + Intergenic
1194939026 X:99987166-99987188 CACTATCTTCAGATATCTTATGG - Intergenic
1194941692 X:100017712-100017734 TGCTAATTTCAAATAAATGATGG + Intergenic
1195099530 X:101540949-101540971 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1195647453 X:107248841-107248863 TAATATCTTCAAAGTTCTGAGGG - Intergenic
1195715127 X:107811082-107811104 GGTTTTCTTCAAATATTTGAAGG - Intergenic
1196096081 X:111801437-111801459 TGATAACTTTAACTATCTGAGGG + Intronic
1196175777 X:112637820-112637842 TTAAATCTTCATATATCTGAAGG - Intronic
1196249678 X:113446052-113446074 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1197541372 X:127766013-127766035 TGATATATTCAAATTGCTGAAGG + Intergenic
1197800465 X:130342462-130342484 AGCTGTCTTTAAATATTTGAAGG + Intronic
1198830544 X:140745341-140745363 TGCTGTCTTCAAGTATCAAAAGG - Intergenic
1198970929 X:142278907-142278929 TCGTATATTCAAATATCTAATGG + Intergenic
1199167538 X:144694931-144694953 TGCTCTGTTCAAATCTCTAAAGG + Intergenic
1199530128 X:148837283-148837305 TACTATCTTCCAACAACTGAAGG + Intronic
1200305343 X:155020118-155020140 TGATATCTTCTGATATCTGGTGG - Intronic
1201434964 Y:13947698-13947720 AGCTCTCTTCAAATATTTAAAGG + Intergenic
1202302288 Y:23429389-23429411 TGCTATCTTCAAAAATATCAAGG - Intergenic
1202568523 Y:26241209-26241231 TGCTATCTTCAAAAATATCAAGG + Intergenic