ID: 1085491580

View in Genome Browser
Species Human (GRCh38)
Location 11:76924058-76924080
Sequence CCTTGGCAGGCTCCCTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085491580_1085491592 23 Left 1085491580 11:76924058-76924080 CCTCATCAGGGAGCCTGCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 216
Right 1085491592 11:76924104-76924126 TGCTGTGGCTTGAGTACTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1085491580_1085491588 8 Left 1085491580 11:76924058-76924080 CCTCATCAGGGAGCCTGCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 216
Right 1085491588 11:76924089-76924111 GGTACTCCCTCCTTATGCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085491580 Original CRISPR CCTTGGCAGGCTCCCTGATG AGG (reversed) Intronic
900995420 1:6120959-6120981 CCTCTGCAGGCCCCCTGGTGAGG - Intronic
903447087 1:23429458-23429480 ACTTGGCAGGGTCCCTGATCTGG + Exonic
904286119 1:29454178-29454200 CCTTTGCAGCCTCCCTCCTGTGG - Intergenic
904418135 1:30375203-30375225 CCTTTGCAGCCTCCCTCCTGTGG + Intergenic
905308412 1:37034142-37034164 CCGTGGCGGGCTCCCTGGGGCGG + Intergenic
905314425 1:37072643-37072665 CCCGGGCAGCCTCCCTGATGTGG - Intergenic
907526960 1:55059377-55059399 CCCTGGCAGGGACACTGATGAGG + Intronic
908416477 1:63917854-63917876 CCTCTGCAGGCTCAGTGATGTGG + Intronic
915111646 1:153567722-153567744 CCTGGGAAGGCTCCCTGCAGTGG - Intronic
917648139 1:177048679-177048701 CCATGGCTTGCTCCCTAATGTGG + Intronic
918117356 1:181508669-181508691 CCTTGGCAGGCTGTATGTTGGGG + Intronic
1062837405 10:644728-644750 CCTGCCCAGGCTCCCTGAAGTGG - Intronic
1063124819 10:3128764-3128786 CCTGGGAATGCTCCCTCATGCGG - Intronic
1067830200 10:49607337-49607359 CCTGGGCTGGCTCCCTAAGGAGG - Intergenic
1067931399 10:50565782-50565804 CCTTCTCAGCATCCCTGATGAGG - Intronic
1068553804 10:58435483-58435505 GCATGCCAGGCTCACTGATGTGG - Intergenic
1070801464 10:79246738-79246760 CCTTTGCAGGCTCCCTCGTGAGG - Intronic
1072031475 10:91526299-91526321 GCTTGGCAGGCTGCCAGCTGAGG + Intergenic
1072917307 10:99546145-99546167 CCTTGGAAGGTTCCCTTAAGTGG - Intergenic
1074780745 10:116800312-116800334 CCCTGGCTGGCTCCATCATGGGG + Intergenic
1076430007 10:130395163-130395185 CCATGGCTGGCTCGCTGATTAGG - Intergenic
1076540701 10:131213031-131213053 GCTTGGCTGCCTGCCTGATGGGG - Intronic
1076883716 10:133251921-133251943 CCTGGGCAGGGGCCCTGCTGTGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077844901 11:6013448-6013470 GCCTGGCAGTCACCCTGATGTGG + Intergenic
1078604985 11:12767149-12767171 ACTTGGGAGTCTCCCTGTTGAGG + Intronic
1078616333 11:12869363-12869385 CCTTGGCTGGCTCCCTGCTTTGG + Intronic
1078855915 11:15206398-15206420 CATTGGGTGGCTCCCTGCTGGGG - Intronic
1078931174 11:15913016-15913038 CCAGGGCAGTCTCCCTGCTGTGG + Intergenic
1079240915 11:18721573-18721595 TCTTGGCGGACTCCTTGATGGGG + Exonic
1080011151 11:27460802-27460824 CCATGGTAGTCTCCCTGCTGAGG + Intronic
1080653829 11:34243034-34243056 CCTTATCAGGCTCCCAGATTCGG - Intronic
1080840348 11:35978019-35978041 CCGTGGCAGACTCCAGGATGTGG + Intronic
1080872479 11:36249125-36249147 CATTGTCAGGCTCTCTGGTGAGG + Intergenic
1082791260 11:57348070-57348092 ACTTGCCAGGGTCCCTGATGGGG + Intronic
1083732640 11:64661035-64661057 CCTGGGCGGTCTCCCTGAGGGGG - Exonic
1083793717 11:65002360-65002382 CCTGGGGAGTCTCCATGATGTGG - Intergenic
1084696934 11:70761338-70761360 GCCAGGCAGGCTCCCTGATCTGG + Intronic
1085259097 11:75194032-75194054 CCTCTGCAGCCTCCCTGATAGGG - Intronic
1085403483 11:76248123-76248145 CCCTGAGAGGCTCCATGATGGGG + Intergenic
1085491580 11:76924058-76924080 CCTTGGCAGGCTCCCTGATGAGG - Intronic
1088098516 11:106128567-106128589 TCTTGGCAACATCCCTGATGAGG + Intergenic
1089254007 11:117184273-117184295 TCTTGGCAGGCTTCTAGATGGGG + Intronic
1091397692 12:163680-163702 CCTGGGCAGGGTCCCTGAAGTGG + Intronic
1091658486 12:2363232-2363254 CCTTGGATGGCTTCCTGATCAGG + Intronic
1096976752 12:55703712-55703734 TCTTTGCTGGGTCCCTGATGAGG - Intronic
1097352445 12:58563006-58563028 CAAGGGCAGGGTCCCTGATGAGG - Intronic
1097844367 12:64351647-64351669 CCATGGATGGCACCCTGATGTGG + Intronic
1098385004 12:69909309-69909331 CCTTGACAGACTCCCTGAGGTGG - Intronic
1100373559 12:93991632-93991654 CCTTGGCCGGCTGCCTGAGAAGG - Intergenic
1101399283 12:104373779-104373801 CCCTGGCAGGCTCCATGAGTAGG + Intergenic
1102140478 12:110611002-110611024 CCTTAGCAGGTTCCCTCATTAGG - Intergenic
1103573146 12:121858023-121858045 CCTTGGCAGGCCTCCTGAGGGGG - Intronic
1105620753 13:22063739-22063761 CTGTGGAAGGCTCCCAGATGAGG + Intergenic
1105927675 13:25021889-25021911 CCTCGTCCGGCTCCCTGAGGAGG + Intergenic
1106417172 13:29555599-29555621 CCTTGGCAGCCACCCTGCAGTGG - Intronic
1110285157 13:73741298-73741320 CCCTGGCAGGCTCCCTTGTATGG - Intronic
1110808867 13:79790621-79790643 TCTAGGCAGGCTGTCTGATGTGG + Intergenic
1111715282 13:91872038-91872060 CCTTGGCAGTCTCTCTGCTTTGG - Intronic
1112748701 13:102556774-102556796 TCTTGGTAGGATCTCTGATGAGG - Intergenic
1114460825 14:22885136-22885158 CTGTGGCAGCCTCCCTGAAGAGG + Intronic
1119383932 14:74245592-74245614 CCTGGGCAGGGTCTCTGTTGAGG + Intronic
1120603487 14:86542133-86542155 CGTAGGGAGGCTCCCTCATGGGG + Intergenic
1121568198 14:94926222-94926244 CCCAGACAGGCTCACTGATGTGG - Intergenic
1122839671 14:104451137-104451159 TCTTGGCAGGCGCCATGGTGGGG - Intergenic
1122909331 14:104819420-104819442 GCTTGGCTGGCTCCCAGCTGGGG - Intergenic
1124100315 15:26686912-26686934 CCTTGGCACTTTCCCAGATGCGG - Intronic
1124352747 15:28969872-28969894 CCTTGGCAGGCTCCATGAGTAGG - Intronic
1125959161 15:43814347-43814369 CCTTGGCAGACTAGCTGCTGAGG - Intronic
1126736652 15:51737640-51737662 CCTTGGCAAGCTCCCCGACCCGG - Exonic
1127328587 15:57917924-57917946 CCTCGGCAGGCCCTCTGAAGTGG - Intergenic
1127356373 15:58204832-58204854 CCTTGCTTGGCTCCCTGCTGGGG + Intronic
1128345735 15:66851352-66851374 CCGTGGCAGGCTCCCTCTGGCGG + Intergenic
1129392247 15:75226279-75226301 CCTTGGAGGGCTCCATGAGGAGG + Intergenic
1129670654 15:77606040-77606062 CGTTGGCAGGCTGCCTGAGAAGG + Intergenic
1129732522 15:77940257-77940279 CCTTGGAGGGCTCCATGAGGAGG - Intergenic
1131076645 15:89499388-89499410 CCTTGGGGGACTCCTTGATGGGG + Intergenic
1131926106 15:97385709-97385731 CCTTTGGTGGATCCCTGATGGGG + Intergenic
1132356154 15:101172990-101173012 CCTTGGCTTCCTCCGTGATGAGG + Intergenic
1132568759 16:635068-635090 CCTTGGCTGACTCCCTCTTGGGG - Intronic
1132621687 16:870869-870891 CCCTGCCAGGCTCCGTGGTGCGG - Exonic
1132729783 16:1355742-1355764 CCTTGGCAGGGTCCTGGATCTGG + Intronic
1132931452 16:2461048-2461070 CCTTGGCAGGCACCGTGGTCTGG - Exonic
1134310442 16:13071334-13071356 GGTTGGCAGGCTCTCTGATGAGG + Intronic
1136398787 16:30006739-30006761 CCAGGGCAGGCTCCCTGGGGAGG + Intronic
1136469989 16:30473670-30473692 CCTGGGCAGGCTGACTGAGGGGG + Intronic
1140211550 16:72974544-72974566 CCTTTGGAGGCTCACTGATAGGG + Intronic
1142283298 16:89160541-89160563 CCAGGGCAGCCTCCCTGTTGAGG - Intergenic
1142780645 17:2178824-2178846 CCTCGGCGGCCTCCCTGGTGCGG + Intronic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1145403769 17:22568973-22568995 CCTACTCAGGCTCCCTGAGGAGG - Intergenic
1147340753 17:39752033-39752055 CAGTGCCAGGCACCCTGATGAGG + Intergenic
1148019915 17:44546921-44546943 CCTGGGCAGGAGCTCTGATGGGG + Intergenic
1148765468 17:50036168-50036190 CCATGTGAGGCTCCCTGAGGAGG - Intergenic
1150040565 17:61855818-61855840 CCTTGGCAGACTACTTCATGAGG - Intronic
1150283083 17:63940648-63940670 CTGTGCCTGGCTCCCTGATGGGG - Exonic
1150915410 17:69431686-69431708 CCTTTGCAGGGTCCCTCATTCGG + Intronic
1152124073 17:78435860-78435882 CCTTGGCCTGCACCCTGCTGAGG - Intronic
1153921068 18:9790563-9790585 CCTTGGCTGGATCCCAGATTAGG - Intronic
1157153138 18:45239456-45239478 CCCGGGCAGGATCCCTGAGGTGG + Intronic
1157577418 18:48752865-48752887 CCTTGGTTGACTCCCTCATGAGG + Intronic
1160610255 18:80078836-80078858 CCTTGGAAGACCCCCTGGTGGGG - Intronic
1161054035 19:2181015-2181037 CCTTGTCAGTCTCCCTGCTGTGG + Intronic
1164615395 19:29664443-29664465 CCAGGGCAGCCTCCCTGAGGAGG + Intergenic
1165015981 19:32880179-32880201 CCTGGCCATGCTCCCCGATGGGG - Intronic
1165721468 19:38082348-38082370 CCTTGGCGGGCTGCCCGTTGTGG - Exonic
1166133785 19:40763169-40763191 TCTGGGCAGGCCCCCTGAGGAGG + Intronic
1166473453 19:43100092-43100114 CCTTGCCAGGATCCGTAATGAGG - Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
925889499 2:8422104-8422126 CCTTGGCTGCCTCCCAGCTGGGG - Intergenic
926052544 2:9754082-9754104 CCTGGCCAGGCTCCATGCTGAGG + Intergenic
927101875 2:19794047-19794069 CCTTGGTGGGCTGCTTGATGTGG - Intergenic
927639978 2:24840133-24840155 CCTTGCCAGGCCCCCTCTTGTGG - Intronic
928455343 2:31415864-31415886 CCCTAGCAGGCTACCTGAGGGGG + Intergenic
929191667 2:39146124-39146146 GCTGGGCAGGATCCCTTATGAGG + Intergenic
929562502 2:42964564-42964586 CCTTGGCTGGCACCCAGCTGTGG + Intergenic
929954605 2:46446692-46446714 CCTTGGTGGGCTCCTGGATGGGG + Intronic
932619733 2:73258472-73258494 CCTGGGCAGGCTGTCTGAAGGGG + Exonic
932764820 2:74462871-74462893 GCTTGCCAGGATCCCTGAAGTGG - Exonic
937097542 2:119245556-119245578 CCTTGCCAAGGTCCCCGATGAGG + Exonic
937116440 2:119408265-119408287 CCCTGGCAGGCTCGCTGAGCTGG - Intergenic
940830683 2:158461854-158461876 CCTTGCCAAGCTCACAGATGTGG - Intronic
940838360 2:158550522-158550544 CCAGGGCTGACTCCCTGATGGGG + Intronic
942994936 2:182249469-182249491 CCTTGTCAGGCCCCCTGAAGTGG + Intronic
943677278 2:190728435-190728457 CCTTCACATGCTCCCTGATATGG + Intergenic
946227680 2:218272890-218272912 CTTTGGCTGGCTCCTTGGTGTGG - Intronic
947163981 2:227242578-227242600 TCTTGGTGGGCTCCCAGATGGGG - Intronic
947321263 2:228921397-228921419 CCTTGGAATGCAACCTGATGTGG + Intronic
947810251 2:232999652-232999674 CCTTGGCAAGCTCCCGCCTGTGG + Intronic
948020617 2:234730334-234730356 GCTTGGCTGGCTCTCTGCTGGGG - Intergenic
948579019 2:238971583-238971605 CCTTGGCAGCCTCCCAGCTGTGG - Intergenic
949002568 2:241624791-241624813 TCTTGGGGGGCTCCCAGATGAGG - Intronic
949065345 2:241986970-241986992 CCTCGGCAGTCTCCTTGCTGAGG - Intergenic
1168849577 20:967337-967359 CCTTGGCAGTCTCCCTCACCTGG - Intronic
1169087842 20:2838449-2838471 CCCTGGCAGGCTCCCTGCGGCGG - Exonic
1169489133 20:6056413-6056435 CCTTGGCAGGCTGCCCCGTGCGG + Intergenic
1170240955 20:14165348-14165370 CCTGGAGAGGCTCCCTAATGTGG - Intronic
1171380901 20:24733254-24733276 CCTTGCCGGGCTCGCTGCTGAGG - Intergenic
1172198541 20:33108994-33109016 CCTTGACTGACTCCCTAATGTGG - Intronic
1172968903 20:38859167-38859189 CCATGGGAGGCTACCTGCTGCGG + Intronic
1173838963 20:46144582-46144604 CCTTGGCTGGCTCCCAGACAGGG + Intergenic
1173842179 20:46165045-46165067 CCTCATCAGGCTCCCTAATGGGG - Intergenic
1174358837 20:50015476-50015498 CCTTGGCAGGGTGGCTGTTGGGG + Intergenic
1175469810 20:59219495-59219517 CCTTGTCAGGATCCCTCATTTGG - Intronic
1175932631 20:62499912-62499934 CCTGGCCTGGCTCCCTGATGCGG - Intergenic
1176649400 21:9531181-9531203 CCTACGCAGGCTCCCGGAGGAGG + Intergenic
1177170266 21:17647646-17647668 ACTTGGGAGGCTGGCTGATGTGG - Intergenic
1177779395 21:25607060-25607082 CCTTGGCAGGTTCCCTGATTTGG - Intronic
1178180113 21:30150399-30150421 CCTTTCCAAGCTCCCTCATGTGG + Intergenic
1178498396 21:33105841-33105863 TCTGGGCAGTCTCCCTGCTGGGG + Intergenic
1180233736 21:46443883-46443905 CTCTGGCAGGGTCCCTGGTGTGG - Exonic
1180621860 22:17167692-17167714 CCTTGGCACGGTCCCTGTGGAGG + Intergenic
950527543 3:13533179-13533201 CCATGTCAGGCTCCCTACTGTGG + Intergenic
951256251 3:20452897-20452919 CCATGGGAGGCACCCTGCTGAGG - Intergenic
952884551 3:38004246-38004268 GCTGGCCAGGCTCCCTGAGGAGG + Exonic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953369685 3:42376730-42376752 CCAGGGCAGGCACCCTGTTGAGG - Intergenic
955085412 3:55697870-55697892 CCTTGGCATTCTCCCAGATAGGG - Intronic
957087795 3:75698770-75698792 CCTAGGCAGGCTCCCCACTGGGG + Intergenic
957626285 3:82656644-82656666 CTTTGGAAGGCTCCATGTTGTGG - Intergenic
963037090 3:141040166-141040188 GCTTGGCAGTCTCCTTGATTTGG + Intergenic
967271891 3:187739278-187739300 CCACGGCAGGGCCCCTGATGCGG - Intronic
968360154 3:198141012-198141034 CCGAGGCAGGACCCCTGATGTGG - Intergenic
968921163 4:3522861-3522883 CCTTGGCACCCTCCATGCTGAGG - Intronic
975147297 4:70982440-70982462 CCTTGGCAGGCTCACTTCTGAGG + Intronic
975712315 4:77173109-77173131 CCTTGGCAGGCAGCCTTCTGTGG + Intronic
975885193 4:78956812-78956834 CCAAGGCAGGCTACCTGTTGGGG + Intergenic
976593914 4:86876298-86876320 CCGTGGGAGGCTTCCTGAGGTGG + Intronic
978710846 4:111778971-111778993 TCTTGGTAGGTTCCCTGATGTGG - Intergenic
979438003 4:120717676-120717698 CCTTGGTAGCCTGTCTGATGGGG - Intronic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985724285 5:1507599-1507621 CCCTGCCAGCTTCCCTGATGTGG - Intronic
985841984 5:2313434-2313456 TCTTGGGAGGCTCACTGATGTGG + Intergenic
985883316 5:2657196-2657218 CCTGGGGAGGGCCCCTGATGGGG - Intergenic
985927165 5:3027450-3027472 ACCCAGCAGGCTCCCTGATGGGG + Intergenic
987100331 5:14585551-14585573 CCTTGGCTGGCTCCCTGGCCTGG + Intronic
988960813 5:36369605-36369627 CCTTGGAAGGGTGCTTGATGAGG - Intergenic
989214562 5:38891536-38891558 CCAGGGGAGGCTCCCTAATGTGG + Intronic
992030646 5:72718072-72718094 CCTTGTCAGTTTCCCTGATGAGG - Intergenic
992538527 5:77738261-77738283 ACTTGGCAGACTCACTGATATGG + Intronic
997464437 5:134077987-134078009 GCCTCCCAGGCTCCCTGATGCGG - Intergenic
997646757 5:135487194-135487216 GCTCAGCAGCCTCCCTGATGGGG + Intergenic
998142106 5:139705851-139705873 CCCAGGCAGGCTCCCAGATCGGG + Intergenic
999754359 5:154653464-154653486 CCTTGCCAGCCTCACTGCTGTGG - Intergenic
1002897479 6:1388130-1388152 CCTAGGCAGGCCCCCTGGGGCGG - Intergenic
1004529143 6:16437329-16437351 CCGTGGAAGGCTACTTGATGCGG + Intronic
1005792285 6:29316124-29316146 CCTTGGCAGGCTCCTGGAAGAGG + Intergenic
1006154296 6:32005971-32005993 CTTTGGCTGTCTCCCAGATGTGG + Intergenic
1006160601 6:32038705-32038727 CTTTGGCTGTCTCCCAGATGTGG + Exonic
1006508967 6:34511549-34511571 CCCTGGCAGGCACCCGGAGGAGG - Intronic
1011111024 6:83836700-83836722 CCCTGGAAAGCTGCCTGATGAGG + Intergenic
1011790648 6:90894910-90894932 CCTTGGCAGGCTCCTTGGCAGGG + Intergenic
1012081692 6:94766369-94766391 CTTTGGAACCCTCCCTGATGCGG + Intergenic
1012770369 6:103425351-103425373 CCTAGGCAGGTTATCTGATGTGG - Intergenic
1012946505 6:105471697-105471719 CCTTTTCATTCTCCCTGATGTGG - Intergenic
1013627296 6:111950850-111950872 GGTTGGCAGGGTCCCTGCTGGGG - Intergenic
1014296313 6:119621931-119621953 CCTTTGCTGGCTCACTGATAAGG + Intergenic
1016390062 6:143565770-143565792 GCTTGGCAGGCTCCATTCTGGGG - Intronic
1017720689 6:157241129-157241151 CCTTGGAAGCCTCCCAGAAGCGG - Intergenic
1017819277 6:158038067-158038089 CCTTGCCAGGCTGCCCGAGGTGG - Intronic
1018952964 6:168391097-168391119 CCTTGGGAGGGCCCCTGAGGGGG - Intergenic
1019259843 7:75619-75641 CCGAGGCAGGACCCCTGATGTGG + Intergenic
1021224850 7:18014838-18014860 CCTTGACCAGCTCCCTGCTGAGG - Intergenic
1023048330 7:36230370-36230392 CCTTGCCAGACTCCTTGATGTGG + Intronic
1023806239 7:43875020-43875042 GCCTGGCAGGCTGCCTGCTGTGG - Intronic
1025027953 7:55533686-55533708 CCTTGCTAGTCTCCCTGATGGGG - Intronic
1026310324 7:69177978-69178000 CCTTGGCACTCTCCCCGACGTGG + Intergenic
1026945527 7:74313662-74313684 CCCTGGCAGGCTCTCCCATGCGG + Intronic
1028088889 7:86672622-86672644 CCATGGCTGGCTCCCTTGTGGGG + Intronic
1030259245 7:107544609-107544631 CCTAGGCAGGCTTTCTGGTGTGG - Intronic
1031847554 7:126824589-126824611 CCATGGCAGGCTCCAAGCTGTGG + Intronic
1032496910 7:132369447-132369469 CCTTGGAAGGCTTCTTGAGGTGG - Intronic
1034285394 7:149880368-149880390 CCTTGCCTGGCTCCCAGCTGGGG + Exonic
1034432290 7:151047086-151047108 CCTTGGCTGGCTGCCTGGTGAGG - Intronic
1034449093 7:151127915-151127937 CCGGGGCAGGCTCCTTGTTGTGG + Intronic
1034452370 7:151143874-151143896 CATTGGCAGGCTCTCTGTTGGGG - Exonic
1035121261 7:156569832-156569854 CCTAGGCAGGCTCCCCGACACGG + Intergenic
1035317994 7:158009140-158009162 CCTTTGCAGGTTCACTGAGGGGG - Intronic
1035611291 8:966074-966096 TCTCGCCAGACTCCCTGATGAGG + Intergenic
1038563676 8:28601667-28601689 CCCTGGCAGCCTCCCTCAGGGGG + Intronic
1038714303 8:29978150-29978172 CCTTGGTAGGCTCTATGTTGAGG - Intergenic
1042633148 8:70843633-70843655 CCTGGGGAGGTTCCCTAATGTGG + Intergenic
1045284032 8:100774367-100774389 ACTTGGGAGGCTCCCTCAGGAGG - Intergenic
1050676639 9:8063072-8063094 GCCTGGCAGGCTCTCTAATGTGG - Intergenic
1051304694 9:15697042-15697064 CCTTGGGAGGCTGCCTTCTGTGG + Intronic
1051569005 9:18534757-18534779 CCTTGGCAGCTTCCATGTTGTGG - Intronic
1051607365 9:18928717-18928739 TCTTGGCAGGCTCCCCCATCAGG + Exonic
1055494750 9:76843165-76843187 CCTTTGCAGGGACACTGATGAGG + Intronic
1057251714 9:93508546-93508568 CCTGGGCAGGCTGCCTGAGCTGG - Intronic
1057669190 9:97073882-97073904 TTTTGGCAGCTTCCCTGATGAGG - Intergenic
1057762946 9:97891129-97891151 TCTGGGCAGGCTTCCTGATGAGG + Intergenic
1060554105 9:124499583-124499605 CCTTGCCAGCCTCCCTGAATGGG + Intronic
1061087877 9:128409676-128409698 CCTTGGCAGACTCACGGACGGGG + Intergenic
1061770840 9:132920077-132920099 CCTTGCCAGACGCTCTGATGAGG + Intronic
1061959295 9:133979847-133979869 CGCCGGCAGGCTCCCTGATGAGG - Intronic
1062744857 9:138204840-138204862 CCGAGGCAGGACCCCTGATGTGG - Intergenic
1203627141 Un_KI270750v1:34729-34751 CCTACGCAGGCTCCCGGAGGAGG + Intergenic
1185835365 X:3341771-3341793 CCTTGGCAGGTCCCATGCTGGGG - Intronic
1199274319 X:145923794-145923816 CCATGGCAGCCTCCCTAATAAGG + Intergenic
1201241303 Y:11959253-11959275 CCTTGGCAGGTCCCATGCTGGGG + Intergenic
1201275160 Y:12290109-12290131 CCTCTGCAGGCTCCATGAGGAGG + Intergenic
1201285236 Y:12373781-12373803 CCCAGGCAGGCCCCCTGAAGTGG + Intergenic