ID: 1085493487

View in Genome Browser
Species Human (GRCh38)
Location 11:76945645-76945667
Sequence GCACCAGTGTTAGTGGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 15, 3: 42, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085493484_1085493487 -5 Left 1085493484 11:76945627-76945649 CCAAAGCAGCATACGCTGGCACC 0: 1
1: 0
2: 3
3: 16
4: 153
Right 1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG 0: 1
1: 1
2: 15
3: 42
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085493487 Original CRISPR GCACCAGTGTTAGTGGGTAC TGG Intronic
903620380 1:24693854-24693876 CCACCAGTGATGCTGGGTACAGG + Intergenic
905964512 1:42081020-42081042 GCAGCAGTGTCAGTGGGTCCAGG + Intergenic
908538764 1:65103217-65103239 GCACCAACGTTAGTGGGTCCTGG + Intergenic
911924983 1:103817889-103817911 GCACTAGTGTTAGTGGGTGCAGG - Intergenic
915056354 1:153134359-153134381 GCACCCATGGTAGTAGGTACAGG - Intergenic
915486992 1:156228398-156228420 GTGCCAGTGTCAGTGAGTACAGG - Intronic
915784833 1:158598032-158598054 ACACCTGTGTTAGCAGGTACTGG - Intergenic
916368548 1:164061787-164061809 GCACCTGTGTCAGTGGGAAAGGG - Intergenic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
920426343 1:205879617-205879639 GCATTAGTGTTAGTGGGTCCAGG + Intergenic
920804122 1:209216925-209216947 GCACCAATGTTAGTGGGCCCAGG - Intergenic
920804649 1:209221148-209221170 GCACCAATGTTAGTGGGCAGTGG - Intergenic
923665311 1:235993630-235993652 GCCCCCGTGTAAGTGGGTGCAGG - Exonic
924629310 1:245721886-245721908 GCCCCAGTGATAGTGGCCACAGG + Intergenic
1063748096 10:8909398-8909420 GCACCAGTGTTAATGTTTTCTGG + Intergenic
1065041757 10:21704990-21705012 GTACTGGTGTTAGTGGGTCCAGG + Intronic
1065823146 10:29544885-29544907 GCACAGGTGTTTGGGGGTACAGG + Intronic
1066564591 10:36707763-36707785 GCCCCAGTGTTAATTGGTACTGG + Intergenic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1068904302 10:62306228-62306250 GCAGCAGTGTTAGGAGGTAATGG + Intergenic
1069092963 10:64223879-64223901 GCACCAGTGTTGGTGGCGACAGG - Intergenic
1070983072 10:80665830-80665852 GCAGCAGGGTTAGTGGGAAGGGG + Intergenic
1071823180 10:89298224-89298246 GCACTGGTGTTAGTGGGACCAGG - Intronic
1073645211 10:105294278-105294300 GCATTGGTATTAGTGGGTACAGG - Intergenic
1076532287 10:131153098-131153120 GCATCAGTATTAGTGGGTCCAGG + Intronic
1078036106 11:7806580-7806602 GCACCAGCATTAGTGGGTCGAGG - Intergenic
1079182459 11:18205292-18205314 GCACTAGTGTTAGAGGGTCTTGG - Intronic
1079868599 11:25766433-25766455 GCACCAGTGTTTCTGGCTACTGG + Intergenic
1081244468 11:40747050-40747072 GCATCAGTGTTAGCTGGTAAAGG - Intronic
1083326576 11:61876094-61876116 GCACCAGTGAGTGTGGGTGCTGG - Exonic
1083581943 11:63830587-63830609 ACACCAATGTTAGTGGGGAGGGG + Intergenic
1083811067 11:65107343-65107365 GCACCAGGGTTAGGGGGTTACGG + Intronic
1085249559 11:75133755-75133777 TCACCTGTGCTAGTGGGAACTGG - Intronic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1085978745 11:81694660-81694682 GCACCAGTGTTATTGGATCCAGG - Intergenic
1089945149 11:122462532-122462554 GCATCAGTGTTCGTGGTTACTGG - Intergenic
1091432819 12:451306-451328 CCACCAGTGTTAGTGTTTCCAGG + Intergenic
1093063646 12:14633125-14633147 GTACCAGCGTTAGTGGGTCTAGG - Intronic
1095976453 12:47943559-47943581 GCACCAGTGGGAGTGGGGATGGG - Intergenic
1096900577 12:54875888-54875910 GCTCCAGTGTTTGTGGGTCCTGG - Intergenic
1097630024 12:62049437-62049459 CAACCAGTGTTATTGGGAACAGG + Intronic
1098129926 12:67339757-67339779 GCATCAGTGGTAGTGAGTCCAGG + Intergenic
1098634023 12:72758278-72758300 GCACCAGTGTTAGCATGTCCAGG - Intergenic
1099519376 12:83641942-83641964 GCACTGGTGTTAGTGGGTCCAGG + Intergenic
1099859490 12:88209179-88209201 GCACCTGTGTTGGTGGTTACTGG - Intergenic
1100670223 12:96803437-96803459 GCTCCAGTGTTAGTGAATCCTGG - Intronic
1105962218 13:25352541-25352563 GCACATGTGTGAGGGGGTACTGG + Intergenic
1107286675 13:38801773-38801795 GTACCAGTATTAGTGGGTCATGG + Intronic
1111176713 13:84605707-84605729 GCACCAGGGTTAGCAGGTCCAGG + Intergenic
1112080121 13:95959817-95959839 GCACCAGTGTTAGCAGGTGCAGG - Intronic
1112821722 13:103345705-103345727 GCACCAGCGTTAGCAGGTCCAGG + Intergenic
1115695760 14:35897479-35897501 GCACTGGTGTTAGTGGGACCAGG + Intronic
1117955473 14:61120232-61120254 GCAGCAGTGTTAGTGGCAAAGGG - Intergenic
1118575320 14:67236579-67236601 GCACCAGTGTAATTCAGTACAGG - Intergenic
1118853655 14:69604354-69604376 CCAGCAGGGTTAGTGGGTGCAGG - Intergenic
1123765098 15:23470509-23470531 GCACACATGTGAGTGGGTACAGG + Intergenic
1124625263 15:31304135-31304157 GCACTAGTGTGAGTGGGAGCCGG + Intergenic
1125155872 15:36584703-36584725 GCCCCAGTGTGAGTGAGTATGGG - Intronic
1127047500 15:55042941-55042963 GCACCAGTGGTATTGAGTTCAGG + Intergenic
1130166088 15:81460753-81460775 GCTCCAGTGTTAGTGGGTCCTGG + Intergenic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1136651188 16:31673073-31673095 GCACCAGTAGCAGTGGGTAGTGG + Intergenic
1138591700 16:58002738-58002760 CCACCAGTGTTAGAGGTTTCTGG - Intronic
1138915314 16:61456111-61456133 GCATCAGTGTTAGTGGGTCCAGG - Intergenic
1149231381 17:54537693-54537715 GTTCCAGTGTTGGTGGCTACAGG + Intergenic
1153041954 18:821306-821328 GTTCCACTGCTAGTGGGTACAGG + Intergenic
1154304685 18:13221995-13222017 GCCGGAGTGTTAGTGGGTTCTGG - Intronic
1158193700 18:54860395-54860417 GCACGAGTGTCATTGGTTACAGG - Intronic
1159111873 18:64069337-64069359 GCACTGGTGTTAGTGGGTTCAGG + Intergenic
1160354552 18:78216030-78216052 CCTCCAGTGTCAGTGGGGACAGG + Intergenic
1160510875 18:79452654-79452676 GCACCAGTGTAGCTGGGCACAGG + Intronic
1162633435 19:11946477-11946499 GCAGCAGTGTTAGTGGCAAAGGG - Intronic
1163376139 19:16931638-16931660 GTACCAGTGTTAGTGGGTCCAGG - Intronic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
1167986506 19:53322833-53322855 GCACCAATGTTAGTGAGTCCAGG + Intergenic
925698844 2:6612970-6612992 GTCCCAGTGTTGGTGGTTACAGG - Intergenic
927834269 2:26379508-26379530 GGAACAGTGTTATTAGGTACTGG + Intronic
929231397 2:39564466-39564488 GCACCAGTTGTAGTGGGTCCAGG + Intergenic
930539111 2:52681634-52681656 GCACCAATGTTAGCAGGTCCAGG - Intergenic
930555749 2:52894149-52894171 GCACCAGTGTTGGTGGACCCAGG + Intergenic
932126752 2:69151727-69151749 GCACCTGTGTGAATGGGTTCAGG + Intronic
932978095 2:76629231-76629253 GCACCTGTGTTGGTGTTTACTGG + Intergenic
936818162 2:116485115-116485137 GCACTGGTGTTAGTGGATCCAGG - Intergenic
937465587 2:122130801-122130823 GTACCAGTGTTAGTTGGTCCAGG + Intergenic
940362592 2:152812756-152812778 ACACCAGAGTTAGCGGGTCCTGG + Intergenic
942376476 2:175343269-175343291 GTACTGGTGTTAGTGGGTCCAGG + Intergenic
943714404 2:191134394-191134416 GCACCAGTGTTAGCAAGTCCAGG - Intronic
944591850 2:201225255-201225277 GCAAGGGTGTTGGTGGGTACAGG - Intronic
944754232 2:202743096-202743118 GCACCAGTATTGGTGGGTCTGGG - Intronic
945483706 2:210370245-210370267 GCACCAGTGTCAGTGGGTCCAGG + Intergenic
945866446 2:215181968-215181990 GCAATGGTGTTAGTGGGTTCTGG + Intergenic
945971152 2:216233580-216233602 GCACCAGTGTGAGCAGGTTCAGG + Intergenic
946694064 2:222334004-222334026 GCACTGGTGTTAGTGGGTTCAGG - Intergenic
947401689 2:229736823-229736845 GCACTAGTGTTAGTGGGTTCAGG - Intergenic
948964356 2:241365269-241365291 GGATCAGTGGAAGTGGGTACAGG - Intronic
1170093439 20:12617730-12617752 GCACCAGTGTTAGCAAGTCCAGG - Intergenic
1171060674 20:21956546-21956568 ACATTAGTGTTAGTGGGTTCAGG + Intergenic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1176876188 21:14131265-14131287 GCCCCAGTGCTAGTTGGTCCTGG - Intronic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1178777534 21:35566353-35566375 GTACCAGTGTGTGTGGGGACAGG - Intronic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
1179784395 21:43721186-43721208 GGACCAGCCTTAGTGGGCACAGG + Intronic
1181363003 22:22353201-22353223 GCATCAGTGTTGGTAGCTACAGG + Intergenic
1181995131 22:26872310-26872332 GTAACAGTGTTACTGGATACAGG - Intergenic
955425013 3:58778666-58778688 GATCCTGTGTTAGTGGGTCCAGG - Intronic
956612032 3:71134094-71134116 GCACCAGTGTGAGCGGGTTTGGG - Intronic
958640026 3:96794382-96794404 GCACTAGTGTTAGCAGGTCCAGG + Intergenic
960014477 3:112871456-112871478 ACACCAATGTTAGTGGGTCCAGG + Intergenic
960551291 3:118978493-118978515 GTACCAGTGTTAGCGGGTCCAGG - Intronic
960586520 3:119325503-119325525 GCAACAGTGTGAGTGGGAAGAGG - Intronic
962592612 3:136906524-136906546 GCACCAGTGTTAGCAGGTTCAGG + Intronic
962881353 3:139579521-139579543 GAACCAGGGTTGGTGGGTATTGG + Intronic
966694534 3:182777042-182777064 GTACCAGTATTAGTGGGTCCAGG + Intergenic
967460952 3:189744818-189744840 GTACCATTGTTAGTGAGTCCAGG - Intronic
970757501 4:19443752-19443774 GCACTGGTGTTAGTGAGTCCAGG - Intergenic
971732841 4:30407390-30407412 TCACCAGTGTTAGTAGTTTCAGG - Intergenic
972071730 4:35028230-35028252 GCAACATTGTAAGTGTGTACAGG + Intergenic
976984753 4:91280184-91280206 GCACCAGTGTTAGTGGGTTTAGG + Intronic
978422415 4:108546814-108546836 GCACTGGTGTTATTGGGTCCAGG - Intergenic
981998626 4:151001797-151001819 GCACCAGTATCAGTGGGTTGAGG - Intronic
982170449 4:152656300-152656322 GCACTGGTGTTAGTGTGTCCAGG - Intronic
982190908 4:152854893-152854915 GCACCAGTGTTAATGGGTCCAGG + Intronic
983593718 4:169442149-169442171 GCACTGGTGATAGTGGGTCCAGG - Intronic
985751549 5:1681555-1681577 ACACTAGTGTTAGTGGGTCCAGG + Intergenic
986011068 5:3715790-3715812 ACACCAATGTTAGTGGAAACAGG + Intergenic
989515463 5:42337679-42337701 GCACAGGTGTTAATGGGTCCAGG - Intergenic
990745091 5:58950791-58950813 GCATCAGTGTTAGTGTGTCCAGG - Intergenic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
994263398 5:97686028-97686050 GCACCAGTGCTGGTGTGTTCTGG - Intergenic
994871981 5:105362732-105362754 GCTCCAGTGTTAGTGGGTCTAGG - Intergenic
995991813 5:118248169-118248191 GCTCTAGTGTTAGTGGGTCCAGG - Intergenic
996223347 5:120960389-120960411 TCATCAGTGTTAATGGGTCCAGG + Intergenic
996327210 5:122288508-122288530 GTCCCAGTGTTAGTGAGTATGGG + Intergenic
998752761 5:145340805-145340827 GCACTAGTGTGAGTGGATATAGG - Intergenic
998926312 5:147130268-147130290 GCACCAGTGTTGATGGTTACTGG + Intergenic
1000800072 5:165714696-165714718 CCTCCAGTGTTACTGGGTCCAGG + Intergenic
1001267137 5:170281783-170281805 GCACCATTGGTAATGGCTACAGG + Intronic
1005158508 6:22835183-22835205 GCTCTAGTGTTAGAGGGTCCTGG - Intergenic
1005798172 6:29390650-29390672 GCACCAATGTTAGCGGGTTTAGG + Intronic
1006688878 6:35862229-35862251 ATTCCAGTGTTAGTGGGTCCTGG - Intronic
1008699437 6:54081118-54081140 GCATCAGTGTCAGAGGGTACTGG - Intronic
1010613582 6:77985494-77985516 GCACCTGTGGTAGTGGTTACTGG - Intergenic
1010902200 6:81441636-81441658 GTACCAGTGTTGGTGGGTCTAGG + Intergenic
1012654309 6:101795471-101795493 GCACGTGTGTTAGTGGGCTCAGG + Intronic
1016247129 6:141995422-141995444 GCACCAGTGTTAGAGGGTGCAGG - Intergenic
1017384040 6:153861882-153861904 GCACTGGTGTTAGTGAGTCCAGG - Intergenic
1022985703 7:35651287-35651309 GCACCAGTGTGAGATGGTCCAGG - Intronic
1024015531 7:45311313-45311335 GAACCAGTTTTAGTGGGTCCAGG + Intergenic
1027228808 7:76260702-76260724 GCACTAGTGTTGGTGGGCACGGG - Intronic
1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG + Intronic
1028031931 7:85926669-85926691 TCACTAGTGTTAGTGAGGACTGG + Intergenic
1028037122 7:85998988-85999010 GTACCAGTGCTAGTGGTCACTGG - Intergenic
1028344434 7:89761709-89761731 GCACTAGTGTTTGAGGGTCCTGG - Intergenic
1031063357 7:117076644-117076666 GCACCCAGGTGAGTGGGTACAGG + Intronic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1034741686 7:153479388-153479410 GCACCAATTTTAGTGGCTACAGG - Intergenic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1038251032 8:25904422-25904444 CCACCAGTGTTTGGGGGTAAGGG + Intronic
1038997780 8:32945212-32945234 GCACCAGTGTCAGTGGGTTCAGG + Intergenic
1042649402 8:71023547-71023569 GCACTGGTGTTAGTGGGCCCAGG + Intergenic
1043116151 8:76255661-76255683 GCACCAGTGTTATTGGTTCTAGG - Intergenic
1044072482 8:87778947-87778969 GCATCAGTGTTAGTGAGTCCAGG - Intergenic
1045945447 8:107789547-107789569 GCACCTGTGTTGGTGGTTACTGG - Intergenic
1047170649 8:122489371-122489393 TGTCCAGAGTTAGTGGGTACAGG - Intergenic
1050112760 9:2233768-2233790 GGAAGAGTGTTAGTGGGAACAGG + Intergenic
1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG + Intergenic
1051766184 9:20526335-20526357 GTAGTAATGTTAGTGGGTACTGG - Intronic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1056176958 9:84045029-84045051 GCACCATTTTTAGTGGGTCTAGG + Intergenic
1187496463 X:19799836-19799858 CCACCAGTGTGAGTGTGTAGTGG - Intronic
1188244625 X:27824850-27824872 GGCACAGTGTTAGTGTGTACTGG - Intergenic
1188285038 X:28316210-28316232 GCACCACTGTTAGTAGGTATAGG - Intergenic
1188757850 X:33986908-33986930 GCACCAGTGTTAGTGGATCCAGG + Intergenic
1190892997 X:54587155-54587177 CCACTAGTGTTAGTGTGTCCAGG - Intergenic
1191107997 X:56784069-56784091 GGGGCAGTGTGAGTGGGTACAGG + Intergenic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1193296070 X:79831811-79831833 GCACTGGTGTTAGTGGGTCTGGG - Intergenic
1193450327 X:81657803-81657825 GCTCCAGTTTTAGTGGTTATTGG + Intergenic
1193555995 X:82953834-82953856 GCACCAGTGTTAATGGGCTCTGG - Intergenic
1194393090 X:93345797-93345819 GAACCAGTGTTACTGGGTTTGGG - Intergenic
1195664068 X:107412787-107412809 GATCCAGTGTTAGTGGGTGTTGG + Intergenic
1195736637 X:108018957-108018979 GCACCACTGTTAGTGTGTCCAGG + Intergenic
1196137143 X:112222375-112222397 GCTCCAGTGGCTGTGGGTACTGG - Intergenic
1196574906 X:117305717-117305739 GCACTAGTGTTAGTGGGTCCAGG - Intergenic
1197034212 X:121854504-121854526 GCAACAGTGCTGGTGGCTACAGG - Intergenic
1197167182 X:123391524-123391546 GCACCAGTGGTAGTAGCAACAGG + Intronic
1197309192 X:124883504-124883526 GCACCAGTCTTAGTGGGTCCAGG + Intronic
1197548861 X:127862479-127862501 GCACCATTGTTAGCAGGTCCAGG - Intergenic
1198299113 X:135317408-135317430 GCACCATTGTTAGCAGGTCCAGG + Intronic
1200743229 Y:6877702-6877724 GCACCAATGTTACTGGGTCCTGG - Intergenic
1202042443 Y:20699342-20699364 GCACTAATGTTAGTGGGTCTAGG + Intergenic