ID: 1085496726

View in Genome Browser
Species Human (GRCh38)
Location 11:76977665-76977687
Sequence GCAAAGATGCTGGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 6, 1: 19, 2: 32, 3: 126, 4: 411}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085496720_1085496726 28 Left 1085496720 11:76977614-76977636 CCTAGTAACGAGGCTTTTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1085496726 11:76977665-76977687 GCAAAGATGCTGGCTGCAGCAGG 0: 6
1: 19
2: 32
3: 126
4: 411
1085496722_1085496726 -4 Left 1085496722 11:76977646-76977668 CCCAGTTAGAGCAGCCACTGCAA 0: 1
1: 0
2: 2
3: 15
4: 132
Right 1085496726 11:76977665-76977687 GCAAAGATGCTGGCTGCAGCAGG 0: 6
1: 19
2: 32
3: 126
4: 411
1085496718_1085496726 29 Left 1085496718 11:76977613-76977635 CCCTAGTAACGAGGCTTTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1085496726 11:76977665-76977687 GCAAAGATGCTGGCTGCAGCAGG 0: 6
1: 19
2: 32
3: 126
4: 411
1085496723_1085496726 -5 Left 1085496723 11:76977647-76977669 CCAGTTAGAGCAGCCACTGCAAA 0: 1
1: 0
2: 2
3: 21
4: 161
Right 1085496726 11:76977665-76977687 GCAAAGATGCTGGCTGCAGCAGG 0: 6
1: 19
2: 32
3: 126
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085496726 Original CRISPR GCAAAGATGCTGGCTGCAGC AGG Intronic
900233862 1:1577311-1577333 GGGAAGATGCTGGCTACAGCAGG + Intergenic
900480056 1:2893889-2893911 GCAAGGAGGCTCGCTGTAGCGGG + Intergenic
900658351 1:3771266-3771288 CCAGAGAGGCTTGCTGCAGCAGG - Intronic
901003965 1:6162793-6162815 GCACAGAGGCTGCCAGCAGCTGG + Intronic
903969798 1:27111161-27111183 GCTAAGAGGCTGTCTGCCGCTGG - Intronic
904700315 1:32353998-32354020 TCAAGAATGCTGGCTGCAGAGGG - Intronic
905001136 1:34671127-34671149 GCCATCATGCAGGCTGCAGCAGG + Intergenic
905309785 1:37041320-37041342 GTTAGAATGCTGGCTGCAGCAGG + Intergenic
905892138 1:41524208-41524230 GCAGAGAAGCTGGGTGGAGCAGG + Intronic
907020064 1:51059003-51059025 GTGAAGATGCCGGCTTCAGCAGG + Intergenic
907152817 1:52305524-52305546 GCCATCATGCTGGCTGCAGCAGG + Intronic
907614664 1:55912330-55912352 GCCATGATACTGGCTGCAGTTGG + Intergenic
908932535 1:69334344-69334366 GCAAAGTTGCCTGTTGCAGCAGG + Intergenic
910101668 1:83583802-83583824 GTGAAGATGCCAGCTGCAGCAGG - Intergenic
911475531 1:98367699-98367721 GCAAAGACACTGGCTGCAGTGGG - Intergenic
911497808 1:98651482-98651504 GCAAAGACACTGGCTGCAGCTGG - Intergenic
912013864 1:105006180-105006202 GTGAAAATGCTGGCTGCAGCGGG - Intergenic
912093630 1:106113644-106113666 GCAAAGATGTAGGCTGCAGCAGG + Intergenic
912384093 1:109262775-109262797 GCAAAGATGGTGGCGGCACAAGG - Intronic
912881974 1:113424216-113424238 GCGAGGATGCCAGCTGCAGCGGG - Intronic
913972287 1:143424133-143424155 GCAACGCTGCTGGCTGGGGCTGG - Intergenic
914066669 1:144249746-144249768 GCAACGCTGCTGGCTGGGGCTGG - Intergenic
914112484 1:144716608-144716630 GCAACGCTGCTGGCTGGGGCTGG + Intergenic
914331061 1:146671260-146671282 GAGAAGAAGCTGGCTGCAGATGG - Intergenic
915828885 1:159106319-159106341 GTGAAGATGCTGGCTGTAGCAGG - Intronic
916334555 1:163655855-163655877 GCAAAAATGTTGGCTGCTGTTGG + Intergenic
916478871 1:165197170-165197192 GCAGATGTGCTGGCTGGAGCTGG - Intergenic
916563866 1:165956271-165956293 GCTAAGAGGCTGGGTGCAGAGGG + Intergenic
919205857 1:194420948-194420970 GCAAAGATGCAAGCTGCAGTGGG - Intergenic
919263882 1:195237269-195237291 GCAAAGATACTGGCTGCAGTAGG + Intergenic
919314125 1:195948899-195948921 GCCATCATGCTGGCTGCAGCAGG - Intergenic
919553945 1:199028449-199028471 GCAGAGATTCTGGCAGCAGCTGG - Intergenic
919802664 1:201362997-201363019 CCAAGGAGGCTGGGTGCAGCTGG - Intronic
920269389 1:204751982-204752004 GCCATCACGCTGGCTGCAGCAGG + Intergenic
920672916 1:208018240-208018262 GCAAAGAGGCTGGAGGCAGAGGG - Intergenic
921666272 1:217875609-217875631 GCAAAGATGCTGATTGCTGATGG + Intergenic
921902154 1:220462833-220462855 GCCATCATGCCGGCTGCAGCAGG + Intergenic
921982689 1:221275290-221275312 ATCAAGATGCTGGCTGCAGATGG - Intergenic
922041564 1:221903164-221903186 TCAGACATGCTGGCTGCTGCTGG + Intergenic
922745086 1:228038887-228038909 GGAGAGAAGCTGGCTGCAGTAGG + Intronic
1063432269 10:6000661-6000683 GCAAAGCTGGTGGCAGAAGCCGG + Intergenic
1064010190 10:11729631-11729653 GCTAAGATGCCAGCTACAGCAGG + Intergenic
1065125114 10:22566567-22566589 GAGAAGATGCTGGCCGGAGCTGG - Intronic
1065201590 10:23317523-23317545 GCAAAGATGCCGGCTGCAGCAGG - Exonic
1066020824 10:31299291-31299313 GCAGAGCTGCTGGCTGGGGCAGG + Intergenic
1067089307 10:43258527-43258549 GCAAAGCTGCAGGCCACAGCAGG + Intronic
1067146795 10:43700222-43700244 GCAGAGATGCAGACAGCAGCAGG - Intergenic
1067704781 10:48598642-48598664 TCAATGATGCAGGCTGCAGTGGG - Intronic
1068130463 10:52889699-52889721 GCAAAGATGCCAGCTGCAGCAGG + Intergenic
1069731899 10:70622519-70622541 GCCATCATGCTGGCTGCAGCAGG + Intergenic
1069833144 10:71293339-71293361 GCAAAGGTGCAGGCTCCTGCTGG - Intronic
1070096341 10:73340996-73341018 GCCATGATGCTGGCTGCAGTGGG - Intronic
1070398166 10:76031092-76031114 GAATTGATGCTGGCTGGAGCAGG + Intronic
1070810350 10:79294564-79294586 AAAATGATGCTGGCAGCAGCTGG + Intronic
1071209034 10:83316978-83317000 CCAAAGATGCTCTCTGCACCAGG - Intergenic
1072335719 10:94396042-94396064 GCCATCATGCCGGCTGCAGCAGG - Intergenic
1072750545 10:97975389-97975411 ACAGAGATGCTGGCTGCATGGGG + Intronic
1072753164 10:97999059-97999081 GCCATCACGCTGGCTGCAGCAGG + Intronic
1073844937 10:107544562-107544584 GCAAAGATGCCAGCCACAGCAGG + Intergenic
1074769814 10:116725880-116725902 GCAAGCATGCTGAATGCAGCTGG - Intronic
1075147979 10:119898932-119898954 GCAAAGATCCTGGAGGCATCTGG - Exonic
1075644461 10:124088414-124088436 GAAAGGAGGCTGTCTGCAGCAGG - Intronic
1076151969 10:128169666-128169688 GCGTGGAGGCTGGCTGCAGCAGG + Intergenic
1076295876 10:129383872-129383894 GCAAGGAGGCTGTCTGCAGAGGG + Intergenic
1076549443 10:131268192-131268214 TCCAAGATGCCAGCTGCAGCAGG - Intronic
1076589711 10:131574688-131574710 GCCAGGATGAAGGCTGCAGCCGG + Intergenic
1076717108 10:132371773-132371795 GCAAACATGATGGCCGGAGCAGG + Intronic
1077132123 11:978265-978287 GCACAGATCCTGTCTGCAGAAGG - Intronic
1077938719 11:6817806-6817828 GCAAAGATGCCAGAAGCAGCAGG + Intergenic
1079141408 11:17812486-17812508 GCAAACAGGCTGTCTGCTGCTGG + Intronic
1079833544 11:25301399-25301421 CCAAAGATGCTGTTTACAGCTGG + Intergenic
1079882496 11:25944565-25944587 GCTATCATTCTGGCTGCAGCAGG - Intergenic
1080208212 11:29755709-29755731 TCAGGCATGCTGGCTGCAGCAGG + Intergenic
1080208443 11:29756967-29756989 GCAAAGATGCCAGCTGCAGCAGG - Intergenic
1080333785 11:31173929-31173951 GCCATGATGCTAGCTGCAGTGGG + Intronic
1080584163 11:33666314-33666336 GCCATCATACTGGCTGCAGCAGG - Intronic
1080801892 11:35617886-35617908 TCAAAGTTGTTGGCTACAGCGGG + Intergenic
1080967142 11:37225461-37225483 GCTATGATGCTGGCTGCAGTTGG - Intergenic
1081011108 11:37812876-37812898 GCAAAGAAGTCGGCTGCAGCGGG - Intergenic
1081082292 11:38756797-38756819 ACAAAGACACTGGCTCCAGCAGG - Intergenic
1081643699 11:44775651-44775673 CCAAAGATGCTGGCGGACGCTGG - Intronic
1081763384 11:45592579-45592601 GCAAAGAGGCTGGCTGTGGATGG - Intergenic
1081767254 11:45620337-45620359 CCAGGCATGCTGGCTGCAGCGGG + Intergenic
1081874139 11:46397346-46397368 GAAGAGCTGCTGGCTGCATCAGG - Exonic
1082687840 11:56260996-56261018 GCAAAGACAACGGCTGCAGCAGG - Intergenic
1083278424 11:61610784-61610806 GGAAAGAAGCTGGGTGGAGCAGG + Intergenic
1083642957 11:64155349-64155371 GGACAGATGCTGGTGGCAGCCGG + Intronic
1083734593 11:64672167-64672189 GCAGAGAGGCTGGCTGGAGGTGG + Intronic
1083765746 11:64840636-64840658 GGAAACAGGCTGTCTGCAGCAGG + Exonic
1084398756 11:68931656-68931678 GCCATCATGCCGGCTGCAGCAGG - Intronic
1084553401 11:69862436-69862458 CCAAAGGCCCTGGCTGCAGCCGG - Intergenic
1084716717 11:70878898-70878920 GCAGAGAGTCTGGCTGGAGCTGG - Intronic
1085496726 11:76977665-76977687 GCAAAGATGCTGGCTGCAGCAGG + Intronic
1086092604 11:83019969-83019991 GCCATCATGCTGGCTACAGCTGG + Intronic
1086947190 11:92854464-92854486 GTGAAGATGCCAGCTGCAGCAGG - Intronic
1087037794 11:93772349-93772371 TCAGACATGCTGGCTGCACCAGG + Intronic
1087131259 11:94671462-94671484 GTGAAGATGCTGGCTGCAGCAGG + Intergenic
1087396268 11:97603558-97603580 GCAGAAGGGCTGGCTGCAGCTGG - Intergenic
1087407993 11:97752992-97753014 GTGAAGATGCTGGCTGCAGCAGG - Intergenic
1087505858 11:99020584-99020606 GCAAACGTGCTGGCTGGAGTCGG - Intergenic
1088650926 11:111957892-111957914 GCCATGATGCCGGCTGCAGTGGG + Intronic
1088704424 11:112448442-112448464 GCCATTATGCTAGCTGCAGCAGG - Intergenic
1089822700 11:121242121-121242143 GTCATCATGCTGGCTGCAGCAGG - Intergenic
1089823002 11:121246018-121246040 GCCATCATGCCGGCTGCAGCGGG + Intergenic
1090337537 11:125982957-125982979 GGAGAGATGGTGGCTGCATCAGG - Intronic
1090468251 11:126955006-126955028 GCTGAGAGGCTGGCTGAAGCAGG + Intronic
1093525863 12:20102703-20102725 GCAAAGATGCCGACTACAGCAGG - Intergenic
1093765085 12:22953135-22953157 GCCAAGATGCTGGCTGCAGTGGG - Intergenic
1094218422 12:27969932-27969954 GCAAAGAAGCTGACTTCAGAGGG - Intronic
1094424245 12:30302177-30302199 GCACAGATGTGGGCTGCAGTCGG - Intergenic
1094675030 12:32611811-32611833 GCAGTGATGCTGGTTGCAGCGGG + Intronic
1095444214 12:42268126-42268148 GCAAAGACACTGGCTGCAGTGGG - Intronic
1095749584 12:45696265-45696287 CCAGATGTGCTGGCTGCAGCAGG + Intergenic
1095749826 12:45697516-45697538 GCAAAGACGGTGGCTACAGCAGG - Intergenic
1095878026 12:47103381-47103403 GGAAAGATGCGCACTGCAGCAGG + Intronic
1096547798 12:52352980-52353002 ACACTGATGCTGTCTGCAGCAGG + Intergenic
1097040252 12:56152219-56152241 GGAAAGATTGAGGCTGCAGCAGG - Intergenic
1097078704 12:56413590-56413612 GCAAAGACGCCAGCTGCGGCTGG - Intergenic
1097684102 12:62676329-62676351 GCAAAGATGCTGGCTGTAGCAGG + Intronic
1098095825 12:66954937-66954959 GCAAAGAGGGTGGCCGCAGAAGG + Intergenic
1098671559 12:73235952-73235974 AGGAAGATGCTGGCTGCAGCTGG - Intergenic
1098802879 12:74984824-74984846 ACATAGCTGCTGGCTGCAGTGGG + Intergenic
1099049892 12:77768843-77768865 GAAAAGACACTGGCTGCAGTAGG - Intergenic
1099693908 12:85994079-85994101 GCCAAGATGCCAGCTGCAGCAGG - Intronic
1099713716 12:86264448-86264470 GCGAAGACGCGGGCTGCAGCGGG + Intronic
1100177547 12:92048244-92048266 GCAACTCTGCAGGCTGCAGCAGG + Intronic
1100847722 12:98678324-98678346 GCCATCATGCTGGCTGCAGCAGG + Intronic
1100893396 12:99151452-99151474 GGAAAGATGGAGGCTGCAGGGGG + Intronic
1101032171 12:100671473-100671495 ACACAGTTGCTGGCTGGAGCAGG + Intergenic
1101250138 12:102925253-102925275 GCAGATATGCTGACTGGAGCAGG + Intronic
1101941602 12:109103286-109103308 GCCATTATGCCGGCTGCAGCAGG + Intronic
1102649805 12:114432023-114432045 TGAAAGATGCTGGCTGCTGTTGG - Intergenic
1102732978 12:115130720-115130742 GGTAAGTTGCTGGCTGCATCAGG + Intergenic
1103819709 12:123687674-123687696 GTAAAGAGGCTGGGTGCAGTGGG + Intronic
1105571175 13:21604132-21604154 GCAAAGATGGCGGCGGCTGCGGG - Exonic
1106009079 13:25800729-25800751 ACAAGGAGGCAGGCTGCAGCAGG - Intronic
1106423346 13:29602273-29602295 CCGAAGATGCTGGCAGCACCTGG - Intergenic
1106571849 13:30934641-30934663 GCCATCATGCTGGCTGCAGCAGG + Intronic
1107840996 13:44458454-44458476 GCAAAGACGCTGGCTGCAGCTGG + Intronic
1108088144 13:46817911-46817933 GCCATCATGCTGGCTGCAGCAGG + Intergenic
1108854557 13:54776062-54776084 GCAAAGATTCCAGCTGCAGTGGG - Intergenic
1109030164 13:57180172-57180194 GCTATCATGCTGGCTGCATCAGG - Intergenic
1109426041 13:62167646-62167668 GCCACCACGCTGGCTGCAGCAGG + Intergenic
1109563434 13:64078969-64078991 GCCATGATGCCGGCTGCAGTGGG - Intergenic
1109603455 13:64662620-64662642 GCAAGGACGCCAGCTGCAGCAGG + Intergenic
1109633816 13:65086305-65086327 GCCATCATGCTGGCTGCAGCAGG - Intergenic
1109686546 13:65829351-65829373 GTGAAGATGCCAGCTGCAGCGGG + Intergenic
1109687660 13:65843245-65843267 GTGAAGACGCTGGCTGCAGCAGG + Intergenic
1109945013 13:69421191-69421213 GTGAAGACGCTGGCTGCAGTAGG - Intergenic
1110008036 13:70297035-70297057 GCCAACATGCTGGCTGCAGCAGG + Intergenic
1110201008 13:72851093-72851115 GTAAAGATGCCAGCTGCAGTGGG + Intronic
1110777866 13:79431927-79431949 GCCATGATGCTGGCCGCAGCAGG + Intergenic
1110810526 13:79807375-79807397 GCCAAGACCCTGGCTGCAGTAGG + Intergenic
1110980222 13:81888961-81888983 GCAAAGACACCAGCTGCAGCAGG + Intergenic
1111072288 13:83184307-83184329 GCAAGGATGCTGGCTGCAGCAGG - Intergenic
1111119115 13:83823456-83823478 GCGAAGACACTGGCTGCAGCAGG + Intergenic
1111464868 13:88595190-88595212 GTGAAGATGCCAGCTGCAGCAGG - Intergenic
1111843148 13:93474010-93474032 GCCATGGTGCTGGCTGCAGTGGG - Intronic
1113868467 13:113544019-113544041 GCAAAGGTGCCGTCTGAAGCGGG - Intronic
1115893137 14:38055069-38055091 GCAAAGACGTTAGCTGCACCAGG - Intergenic
1116151389 14:41145870-41145892 GAAAAGATGCTGGATGCAGAAGG - Intergenic
1116159870 14:41254156-41254178 GCCAAGATACCAGCTGCAGCAGG - Intergenic
1116356630 14:43938664-43938686 GGGAGGATGCTGGCTGTAGCAGG + Intergenic
1116661687 14:47717679-47717701 GCAACGATGCTGACCGCAGCAGG - Intergenic
1116790119 14:49330502-49330524 GTGAAGATGCCAGCTGCAGCAGG - Intergenic
1116902117 14:50371617-50371639 GCCATGATGCTGGCTGCAGTGGG + Intronic
1116961511 14:50972888-50972910 GCAAAGACTCTGGCTGCAGGGGG + Intergenic
1117078311 14:52126177-52126199 GCAGAGAAAGTGGCTGCAGCAGG - Intergenic
1117733861 14:58750663-58750685 GCCATGATGCTGGCTTCAGGGGG + Intergenic
1117969293 14:61236412-61236434 GTAAAGAAGCTGGCTCCACCGGG + Intronic
1119257042 14:73207860-73207882 CCAGGCATGCTGGCTGCAGCAGG + Intronic
1119257309 14:73209276-73209298 GCAAAGATGGCAGCTGCAGCAGG - Intronic
1120430173 14:84403374-84403396 ACAAAGGTGGTGGCAGCAGCAGG - Intergenic
1120745346 14:88146835-88146857 ACTACCATGCTGGCTGCAGCAGG + Intergenic
1121534739 14:94683822-94683844 GCAGAAACGCTGGCCGCAGCTGG - Intergenic
1121933301 14:97993212-97993234 GCAAAGGTGCTGGGTCCAGCAGG - Intergenic
1202833915 14_GL000009v2_random:63779-63801 GCAAAGAAGCTGGCTGCATGGGG + Intergenic
1123880742 15:24676042-24676064 ACGAAGATGCTGGCTGCTGAAGG - Exonic
1124566949 15:30824749-30824771 GCAAAGATGCTTGCAGCTCCCGG - Intergenic
1124820698 15:33043696-33043718 GCCATGATGCTGGCTGCAGTTGG + Intronic
1124820990 15:33045223-33045245 CCAGGCATGCTGGCTGCAGCGGG - Intronic
1125241429 15:37581886-37581908 GCCATGACGCTGGCTGCAGTGGG + Intergenic
1125241679 15:37583073-37583095 CCAGACATGCTGGCTGTAGCAGG - Intergenic
1125306091 15:38316591-38316613 GCAAATAGACTGGCTGGAGCCGG - Intronic
1126157001 15:45574688-45574710 GCCAAGATGCCAGCTACAGCAGG - Intergenic
1126693214 15:51303928-51303950 GGCAAGATGCAGGATGCAGCAGG + Intronic
1128965416 15:72052767-72052789 CCGAGCATGCTGGCTGCAGCGGG - Intronic
1129183657 15:73892558-73892580 GTATGGGTGCTGGCTGCAGCTGG - Intergenic
1129796619 15:78382310-78382332 GCCATCATGCGGGCTGCAGCAGG + Intergenic
1130183004 15:81651065-81651087 GCCATCATGCTGACTGCAGCAGG + Intergenic
1130227888 15:82073511-82073533 GCCATCATACTGGCTGCAGCAGG - Intergenic
1130518338 15:84643455-84643477 GGAAAGATGCTGGTGTCAGCGGG + Exonic
1130841531 15:87705502-87705524 GGAAAGATGTGGGCTGCAGGAGG - Intergenic
1131605850 15:93901329-93901351 GCAAAGACACCGGCTGCACCAGG - Intergenic
1131860551 15:96648540-96648562 GCAAAAATGCTGGCCAAAGCGGG + Intergenic
1132212679 15:100036089-100036111 GCAAAGATGATGGCTGGCCCAGG + Intronic
1133051289 16:3118836-3118858 GGGGAGATGCTGTCTGCAGCTGG + Intronic
1135986671 16:27189349-27189371 GTGAAGACGCTGGCTGCAGTGGG + Intergenic
1136454196 16:30371145-30371167 GCAAAGATGCTGCCAGCAGGCGG + Intronic
1137252677 16:46751489-46751511 GCTAAGAAGGTGGCTGCGGCTGG + Intronic
1137282887 16:46992915-46992937 GCCATCACGCTGGCTGCAGCAGG - Intergenic
1137588486 16:49679225-49679247 GCAAAGATGCCAGCTGCAGTTGG + Intronic
1137692783 16:50441093-50441115 GCAAAGATGCTAGCTGCAGTGGG + Intergenic
1138033664 16:53580662-53580684 GCCGAGATGCCGGCTGCAGCAGG - Intergenic
1138306236 16:55978252-55978274 TCAAAGATGCTGTCTGCCTCTGG - Intergenic
1138431482 16:56971982-56972004 GAAAGGATGCTGGCTGCAGGAGG - Exonic
1138998106 16:62477608-62477630 GCCATGATGCCAGCTGCAGCAGG + Intergenic
1139015361 16:62683784-62683806 GCAAAGATGCCAGCTGAAGTAGG + Intergenic
1139182977 16:64770073-64770095 GCCAAGACACTGGCTGCAGCAGG + Intergenic
1139641838 16:68297243-68297265 GCAAAGCTGCTGGGTGCCTCTGG - Exonic
1139940315 16:70600913-70600935 GAGAAGATGCTGGCAGAAGCAGG + Intronic
1140002492 16:71039644-71039666 GAGAAGAAGCTGGCTGCAGATGG + Intronic
1140919441 16:79523515-79523537 GCAAAGTGTCTGGCTGCAGTTGG - Intergenic
1141794025 16:86257417-86257439 GCAAAGATAATGGAGGCAGCTGG - Intergenic
1143683070 17:8492013-8492035 GCCAGGATGCAGGCTGGAGCAGG + Intronic
1144287216 17:13788421-13788443 GCAAGGATGCTGTCTGGTGCTGG + Intergenic
1144714346 17:17423939-17423961 GCCATCACGCTGGCTGCAGCAGG + Intergenic
1146425145 17:32731625-32731647 GCCATGATGCTGGCTGCAGTGGG + Intronic
1146747500 17:35345540-35345562 CCAAAGAAGATGCCTGCAGCAGG - Intergenic
1147140781 17:38459568-38459590 GAGAAGATGCTGGGGGCAGCAGG - Intronic
1147526331 17:41227151-41227173 GCAAGAAGGCTGGCAGCAGCTGG - Exonic
1147527362 17:41238503-41238525 GCAAGAAGGCTGGCAGCAGCTGG - Exonic
1147528481 17:41250157-41250179 GCAAAAAGGCTGACAGCAGCTGG - Exonic
1147529011 17:41255867-41255889 GCAAGAAGGCTGGCAGCAGCTGG - Exonic
1147529911 17:41265832-41265854 ACAAGAATGCTGGCAGCAGCTGG - Exonic
1149362828 17:55911857-55911879 GCCATCATGCTGGCTGCAGTGGG - Intergenic
1149557128 17:57581307-57581329 ATAAAGATGCTGACTTCAGCTGG - Intronic
1150868504 17:68879572-68879594 GCAAAGATGCTGGCTGTAGCAGG + Intronic
1150950755 17:69800880-69800902 GTCATCATGCTGGCTGCAGCAGG + Intergenic
1151960201 17:77401845-77401867 GCAGAGATGCAGGCTGGAGTGGG - Intronic
1152075957 17:78159876-78159898 GCACAGATGCAGGCTGCAACAGG - Intronic
1152152261 17:78609479-78609501 CCAAAGCTGCTGGCTTCAGATGG + Intergenic
1153428102 18:4988145-4988167 ACAAAGATGCCAGCTGCAGTGGG - Intergenic
1153428918 18:4993604-4993626 GCAAAGATGCCAACTGCAGTGGG - Intergenic
1154346744 18:13548827-13548849 GCCATGATGCTGGCTGCAGCAGG - Intronic
1154357669 18:13633933-13633955 GTGAAGATGCTGGCTGCAGCAGG - Intronic
1155100844 18:22608239-22608261 GCAGAGATGCTGTCTACAGTTGG + Intergenic
1155176120 18:23302730-23302752 GCAAGGCTACTGGCTGGAGCAGG + Intronic
1156254213 18:35379481-35379503 GCAAAGATCCAGGCTGCAGCTGG + Intergenic
1157506786 18:48231951-48231973 CTAAGCATGCTGGCTGCAGCAGG - Intronic
1158401391 18:57124395-57124417 GCAAAGATGTTTGCTACAGAAGG + Intergenic
1158787906 18:60739287-60739309 GCAAAGATGCTGGCTGCAGCGGG + Intergenic
1159054971 18:63454327-63454349 GCTCAGAAACTGGCTGCAGCAGG + Intergenic
1159196776 18:65125960-65125982 TTAAAGATTCTGGCTGCAGAGGG - Intergenic
1159292305 18:66439382-66439404 GCAAAGATGCTGGCAGCAGCAGG + Intergenic
1159774413 18:72586182-72586204 GCCATGTTGCTGGCTGCAGCAGG - Intronic
1160167600 18:76527918-76527940 GCAAAGATGCAGGGTGCAGAGGG - Intergenic
1161395291 19:4042263-4042285 GCACGAATCCTGGCTGCAGCAGG + Intergenic
1161810115 19:6466682-6466704 GCAGTGTTGGTGGCTGCAGCAGG - Intronic
1162439922 19:10686619-10686641 GCACAGCTGCTGGGTGCAGGTGG - Intronic
1162851057 19:13431275-13431297 GCAAAGATGGGGGCTGGACCGGG + Intronic
1163020190 19:14477495-14477517 ACAAGGCTGCTGTCTGCAGCTGG - Intergenic
1163040596 19:14599376-14599398 GCAAAGATGCAGGCTGCCCATGG - Intronic
1165826638 19:38709455-38709477 CCCAAGATGCTGGATGCAGAGGG + Exonic
1167346006 19:48946250-48946272 GCCATCATGCTGGCTGCTGCCGG + Intergenic
1167843955 19:52144978-52145000 GGAAAGATGCTTACTGCAGAAGG - Intergenic
1168120607 19:54250805-54250827 GCGTAGATGCTGGGTTCAGCTGG + Exonic
1168303259 19:55419228-55419250 GCTATCATGCTGGCTGCAGCAGG + Intergenic
1202638769 1_KI270706v1_random:63913-63935 GCAAAGAAGCTGGCTGCATGGGG - Intergenic
925321837 2:2976361-2976383 ACAGAGATGCTCGCTACAGCCGG + Intergenic
925360372 2:3276513-3276535 CCAAGGGTGCTGGGTGCAGCAGG - Intronic
925832557 2:7910422-7910444 TCAATCATGCTGTCTGCAGCTGG + Intergenic
925954904 2:8954271-8954293 GCAGCTATGTTGGCTGCAGCTGG - Intronic
926043174 2:9690972-9690994 GCGAGGCTGCTGGCTGCAGTGGG - Intergenic
926547146 2:14255675-14255697 GCAAAGATGCCGGCTGCTGTGGG - Intergenic
926589928 2:14729793-14729815 GCAAGGATGCAGAGTGCAGCAGG + Intergenic
926675930 2:15619497-15619519 GCCATCAAGCTGGCTGCAGCGGG - Intronic
927743337 2:25591383-25591405 GCCACGATGCTGGCTGCACTGGG - Intronic
928840321 2:35598415-35598437 GCCATGATGCTGGCTGCAGTGGG + Intergenic
929014442 2:37481128-37481150 GCCAAGATGCTGACTGCAGCGGG + Intergenic
929602567 2:43213473-43213495 GGAAAGATGCTTCCAGCAGCAGG - Intergenic
929847281 2:45542513-45542535 GGGAAGACACTGGCTGCAGCAGG - Intronic
930909645 2:56616505-56616527 GCCAAAATGCTGGATGCACCTGG + Intergenic
932501750 2:72188210-72188232 GCCATCATGCTGGCTGCAGCAGG - Intronic
932644781 2:73488633-73488655 GCAATGATGCCAGCTGCAGTGGG - Intronic
932699460 2:73983703-73983725 GCTAAGCTGTTAGCTGCAGCCGG + Intergenic
933454780 2:82507524-82507546 GCAAAGACACTGGGTGCAGCAGG + Intergenic
933897107 2:86821752-86821774 GCAAAGAGCCCCGCTGCAGCAGG + Intronic
935170744 2:100609915-100609937 GAAAGGAAGCTGGGTGCAGCGGG - Intergenic
935337582 2:102031403-102031425 GAAAAGGAGCTGACTGCAGCCGG + Intergenic
936065179 2:109325811-109325833 GCAAAGATGCTGGCCCGAGCAGG + Intronic
936738423 2:115474984-115475006 GCAAATTTTCTGGCTGGAGCTGG - Intronic
937297842 2:120820469-120820491 GCAAAGAAGCTGGTGGCAGGAGG + Intronic
938722207 2:134076752-134076774 GCCATGATGCTGGCTGCAGTGGG - Intergenic
939017774 2:136921152-136921174 GTAAGGACACTGGCTGCAGCAGG - Intronic
939777540 2:146405490-146405512 GCAAAGATCCTGGGAGCAACTGG - Intergenic
939837545 2:147149820-147149842 GCAAAAATGCCAGCTGCAGCGGG + Intergenic
940366975 2:152859078-152859100 GCACAGAGGCTGGCTGCCCCTGG + Intergenic
940957076 2:159739276-159739298 ACAAAGACGCCGGCTGCAGCAGG - Intronic
941151275 2:161918749-161918771 GCAAAGATGCCAGCTGCAGTAGG + Intronic
941151280 2:161918788-161918810 GCAAAGATGCCAGCTGCAGTAGG + Intronic
941432217 2:165426727-165426749 ACCAAGATGCTGGCTGCAGCAGG + Intergenic
941440411 2:165528792-165528814 GCTATCATGCCGGCTGCAGCAGG + Intronic
941998749 2:171626305-171626327 GTGAAGATGCGGGCTGCAGTAGG + Intergenic
942376579 2:175343834-175343856 GCAGTGATGGTGGCTGCAGTTGG + Intergenic
942585217 2:177467079-177467101 GCAAAGACATTGGCTGCAGTGGG - Intronic
942868188 2:180700227-180700249 GCAAAGATGCTGGCTGCAGCAGG - Intergenic
943063996 2:183068662-183068684 GTAAAGATGCTGGCTGCAGGAGG + Intergenic
943129233 2:183837190-183837212 GCCATGATGCTGGCTGCAGTGGG + Intergenic
943396307 2:187339025-187339047 GCTAAGATGCTGGCTGCAGCCGG - Intergenic
943426888 2:187749209-187749231 CCAAGCATGCTGGCTGAAGCAGG + Intergenic
943858272 2:192827838-192827860 GCGAAAATGCGGGCTGCAGCAGG + Intergenic
944586448 2:201177947-201177969 GCCATCATGCTGGCTGCAGCAGG + Intergenic
944901949 2:204224038-204224060 GCCAAGATGCCAACTGCAGCAGG - Intergenic
947054932 2:226088619-226088641 GCAAGGTTGCTGGCTGCATTGGG - Intergenic
947144201 2:227049690-227049712 GAAAAGATACTGGCTCCTGCGGG + Intronic
947237229 2:227953692-227953714 TAAAAAATACTGGCTGCAGCTGG - Intergenic
947316565 2:228865942-228865964 GCCACAATGCTGGCTGCAGTGGG + Intronic
947530411 2:230905519-230905541 ACAAAGACGCTGCCTGCAGGGGG - Intergenic
948120709 2:235528317-235528339 GCACAGATGGTGGATGGAGCCGG - Intronic
948559455 2:238841879-238841901 GCTCGGAAGCTGGCTGCAGCAGG - Intergenic
948673543 2:239583981-239584003 CCAAAGCTGGTGGCTGAAGCTGG + Exonic
1169148488 20:3270448-3270470 GCAAGAATGAAGGCTGCAGCAGG + Exonic
1170221415 20:13946542-13946564 GCAGAAATGCCAGCTGCAGCAGG + Intronic
1170403108 20:16008964-16008986 TCAAAGATGTTGGCAGCAACAGG - Intronic
1170458282 20:16553759-16553781 ACCAAGACGCTGGCTACAGCGGG + Intronic
1170557818 20:17529713-17529735 GCAAAGATACTCACTGCAGCAGG - Intronic
1170557823 20:17529767-17529789 GCAAAGATACTCACTGCAACAGG - Intronic
1170938353 20:20828380-20828402 TCAATTATGCTCGCTGCAGCAGG + Intergenic
1171181997 20:23097889-23097911 GCTGAGAGCCTGGCTGCAGCAGG - Intergenic
1171237041 20:23535411-23535433 GCCAAGACGCCGGCTGCAGCAGG - Intergenic
1171885362 20:30648033-30648055 GCAAAGAAGCTGGCTGCACGGGG - Intergenic
1172131574 20:32659573-32659595 TCAAAGATAGTGGCTGCTGCAGG - Intergenic
1173207732 20:41007689-41007711 GCCATGATGCAGGCTGCAGTGGG - Intergenic
1173893736 20:46534079-46534101 GCTATCATGCTGGCTGCAGCAGG + Intergenic
1175128228 20:56768426-56768448 ACAAATATGATGGCTGGAGCAGG - Intergenic
1176104448 20:63379352-63379374 GCCATGATGCTGGCTGCCGTCGG + Intergenic
1177037552 21:16061486-16061508 GCAAAGATGCTGGCTGCAGCGGG - Intergenic
1177344774 21:19854480-19854502 TCAAAGACGCTGACTTCAGCAGG - Intergenic
1177344996 21:19855986-19856008 GCAAAGATGCTGGCTGCAGTGGG - Intergenic
1177875539 21:26626549-26626571 GCAAAGATGCTGGCCGCAGCAGG - Intergenic
1179010445 21:37552255-37552277 GCAGGGAAGCTGGCCGCAGCAGG - Intergenic
1179010529 21:37552771-37552793 GCTGACATCCTGGCTGCAGCAGG + Intergenic
1179914328 21:44466745-44466767 GCAACGATGCTGGCTGGAGATGG + Intergenic
1180102728 21:45596895-45596917 GCACAGATGCTGACAGCAGGTGG - Intergenic
1180363198 22:11917976-11917998 GCAAAGAAGCTGGCTGCATGGGG + Intergenic
1181045799 22:20213759-20213781 GCAACGGTACTGGCTGCATCCGG - Intergenic
1182096261 22:27627983-27628005 GCAAGGAAGGAGGCTGCAGCTGG + Intergenic
1182761215 22:32723810-32723832 GCAAGGATCCAGGCGGCAGCCGG - Intronic
1182944552 22:34309800-34309822 GGAATGATGCTGCCTTCAGCAGG + Intergenic
1183025110 22:35058902-35058924 GCCATGATGCCGGCTGCAGTGGG - Intergenic
1183316679 22:37140998-37141020 GCTAAAACTCTGGCTGCAGCCGG + Intronic
1183822941 22:40361576-40361598 GGACAGATGCTGTCTGTAGCGGG - Exonic
1184450847 22:44581972-44581994 GCAGAGATGCTGCTGGCAGCAGG - Intergenic
1184919252 22:47594100-47594122 GCAGAGCTGGTGTCTGCAGCTGG + Intergenic
949248613 3:1955889-1955911 GCAAAGAAGCTAACTGCAGTTGG - Intergenic
950644227 3:14367555-14367577 GAGATGATGCTGGCTGCACCAGG + Intergenic
950994335 3:17479791-17479813 GTGAAGATGCTGGGTGCAGTGGG + Intronic
951739115 3:25900302-25900324 GCAAAGATGGTGACAGCAGATGG - Intergenic
952269459 3:31817416-31817438 CCAAGGATGCAGGCTGCACCAGG + Intronic
952744519 3:36764499-36764521 GCAGAGAGGGCGGCTGCAGCTGG - Intergenic
954099514 3:48358372-48358394 GCCAAGACACTGGCTGCAGCAGG - Intergenic
955057590 3:55470466-55470488 GAAGACATGCTGGCTGCAGCTGG - Exonic
955112023 3:55959021-55959043 GCAAAGATACTGGCTGCAGTGGG - Intronic
955241631 3:57183152-57183174 GCCATCATGCTGGCTGCAACGGG - Intergenic
956902454 3:73730784-73730806 GTAAAGCTGCTGGCTGCTTCTGG - Intergenic
957156354 3:76550458-76550480 GCAAAGACACTGGCTGTAGCTGG + Intronic
957614404 3:82509083-82509105 GCGAAGATGCCAGCTGCAGCAGG + Intergenic
957665471 3:83219100-83219122 ACAAAGACTCTGGCTACAGCTGG - Intergenic
958195143 3:90234973-90234995 GCCAAGATGCCTGCTGCAGCGGG + Intergenic
958678376 3:97294273-97294295 GCAAAGATGCTGGCTGAAGTGGG - Intronic
959037336 3:101383326-101383348 GCAAAGAGGCCGGCTGCAGTGGG + Intronic
959106267 3:102068470-102068492 GCAAAGTTGCTGTCTGCAAGGGG - Intergenic
959147712 3:102569596-102569618 GCACAGATGTTGGCTGCTTCTGG + Intergenic
960014564 3:112871886-112871908 GCACAGATGCAGGCTGTAGTGGG + Intergenic
960510539 3:118544004-118544026 GCAAAGACGGTGTTTGCAGCAGG - Intergenic
961075460 3:123977874-123977896 GAAAAGAGGCTGCCTGCAGCAGG + Intronic
961308226 3:125974642-125974664 GAAAAGAGGCTGCCTGCAGCAGG - Intronic
961351383 3:126306856-126306878 CCAGAGATGGAGGCTGCAGCTGG - Intergenic
962164657 3:133036930-133036952 GCAATGGTTCTGGCTACAGCAGG - Intergenic
962212093 3:133487520-133487542 GCAAAGACGCTGGCTGCAGTAGG - Intergenic
963343517 3:144066955-144066977 TCAATTATGCTGTCTGCAGCAGG + Intergenic
963692161 3:148518644-148518666 TCAAAGATGCTCTCTGCACCAGG - Intergenic
964927396 3:161975515-161975537 GCAAAGACACTGGCTGCAGTGGG - Intergenic
964927959 3:161979561-161979583 GTGAAGACACTGGCTGCAGCAGG - Intergenic
965118756 3:164522732-164522754 GCAAAGATTCCAGATGCAGCAGG - Intergenic
965206289 3:165721409-165721431 GCAAAGATGCCGGCTGCAGCAGG - Intergenic
965272564 3:166638137-166638159 GCCATCATGCTTGCTGCAGCAGG + Intergenic
965541935 3:169879792-169879814 CCAGTGATGCTGGCTACAGCAGG + Intergenic
965924433 3:173959273-173959295 GCAAAAACACTGGCTGCAGTGGG - Intronic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
966254042 3:177898314-177898336 GCCAGGATGCCAGCTGCAGCAGG + Intergenic
966491303 3:180531411-180531433 GCCATCATGCCGGCTGCAGCAGG + Intergenic
968143099 3:196274359-196274381 GCCATGATGCCGGCTGCAGTCGG - Intronic
969119787 4:4899689-4899711 GCAAGGATGCTGCGGGCAGCAGG + Intergenic
969426590 4:7128021-7128043 GCAGAGCTGCTGGCTGCTGGGGG + Intergenic
969627758 4:8316433-8316455 GCAGAGGTGCTGGCTACAGCAGG - Intergenic
972203727 4:36747295-36747317 TCACTCATGCTGGCTGCAGCAGG + Intergenic
972788059 4:42345998-42346020 GTGAAGACGCTGGCAGCAGCAGG + Intergenic
972931201 4:44072778-44072800 GCCATCATGCTGGCTGCAGCAGG - Intergenic
973041024 4:45471282-45471304 ACCAAGACGCCGGCTGCAGCAGG + Intergenic
973369017 4:49230301-49230323 GCAAAGAAGCTGGCTGCACGGGG - Intergenic
973392025 4:49565114-49565136 GCAAAGAAGCTGGCTGCACGGGG + Intergenic
974023294 4:56710987-56711009 GCAAAGACACTGGCTGCAGCTGG + Intergenic
975254565 4:72217165-72217187 GCCAAAATGCCGGCTGTAGCAGG - Intergenic
976675616 4:87698399-87698421 ACCATAATGCTGGCTGCAGCAGG - Intergenic
977487229 4:97664945-97664967 GCAGGGAGGCTGGCTGCGGCAGG + Intronic
977645814 4:99410355-99410377 CCAGGCATGCTGGCTGCAGCAGG + Intergenic
978248449 4:106603594-106603616 CCAGGCATGCTGGCTGCAGCAGG + Intergenic
978610200 4:110529495-110529517 GCAAAGGTGCTGTATGAAGCAGG + Intronic
978663318 4:111153890-111153912 CCAGGCATGCTGGCTGCAGCAGG + Intergenic
978663557 4:111155182-111155204 GCCATGACGCTGGCTGCAGCAGG - Intergenic
978724796 4:111957332-111957354 GCAAAGATGTTCGCTGATGCAGG - Intergenic
978936910 4:114388817-114388839 GAAAAGATGCTGACTCCTGCAGG - Intergenic
979010664 4:115365318-115365340 GCCAAGTCACTGGCTGCAGCAGG + Intergenic
979956030 4:126955357-126955379 CTGAAGACGCTGGCTGCAGCAGG + Intergenic
980731054 4:136824372-136824394 GCCATGATGCTGGCTGCAGTGGG - Intergenic
981052241 4:140320652-140320674 TCCAAGATGCTGGCTGGAGAAGG + Intronic
981125670 4:141103413-141103435 GCAAACATTGTGGCCGCAGCAGG + Intronic
981889335 4:149716611-149716633 GCAAAGATGCCGGCTGCAGCCGG - Intergenic
982802737 4:159723643-159723665 GCAAACATGCTGGCTGCAGCAGG - Intergenic
982856347 4:160386250-160386272 GCAAAGACAACGGCTGCAGCAGG - Intergenic
983825060 4:172249246-172249268 GCAAAGATACTGGCAGCATTTGG + Intronic
984822412 4:183893394-183893416 GCTAAGATGCTGGCCGCAAAGGG - Intronic
1202766107 4_GL000008v2_random:149772-149794 GCAAAGAAGCTGGCTGCATGGGG - Intergenic
985494931 5:199061-199083 GCAAAGACGGTGGCTCCAGATGG - Exonic
986273838 5:6256569-6256591 GCAAAGCAGGTGGCTGCGGCAGG + Intergenic
987281051 5:16414069-16414091 CCAAAGATGCTCACTGCATCAGG - Intergenic
987537587 5:19208469-19208491 GCCAAGATGGCAGCTGCAGCAGG + Intergenic
987952071 5:24687861-24687883 GCAAAGATGCTGGCTGCAGCAGG - Intergenic
989308985 5:39991502-39991524 GCATAGATGCTGGCTTTAGCTGG + Intergenic
989425548 5:41291293-41291315 GCAAAGATGCCAGCTGCAGCCGG - Intergenic
990023571 5:51159331-51159353 GCCAAGACACGGGCTGCAGCAGG + Intergenic
990516373 5:56534622-56534644 GCAGAGACACTGGCTACAGCAGG - Intronic
990638976 5:57761512-57761534 GCTGCCATGCTGGCTGCAGCAGG + Intergenic
991039801 5:62163155-62163177 GCGAAGACGCCAGCTGCAGCAGG - Intergenic
991424446 5:66476248-66476270 CCAAAGATCATGGCTGCAGCTGG - Intergenic
991587718 5:68216410-68216432 GCAGCGACCCTGGCTGCAGCTGG - Intronic
992267387 5:75032575-75032597 GCAAAGATGCTGTCTGGACTTGG - Intergenic
993618180 5:90137471-90137493 GCAAAGATGCCAGTTACAGCAGG - Intergenic
993703469 5:91144212-91144234 GCGGAGATGCTGGCTGCAGAAGG - Intronic
994450113 5:99930185-99930207 GCCATCATCCTGGCTGCAGCAGG - Intergenic
994451447 5:99950056-99950078 GCAAGGATGCCGGCTGCAGAAGG + Intergenic
994593781 5:101806405-101806427 GCTAAGATGCCAGCTGCAGCAGG + Intergenic
994613617 5:102077339-102077361 ACACAGATGCTGGCTGAAGGGGG + Intergenic
995258588 5:110075285-110075307 GCAAGCTTGTTGGCTGCAGCAGG + Intergenic
995331930 5:110956347-110956369 GCCAAGATGCCAGCTGCAGTGGG + Intergenic
995723873 5:115165611-115165633 GCAAAGATGCTGGCTGCAGTTGG + Intronic
996496053 5:124158031-124158053 GCAAAGAACCTGGCTGCTCCTGG + Intergenic
997724436 5:136108616-136108638 GCAAGGATGCTTGCTACATCAGG + Intergenic
997933447 5:138090590-138090612 ACAGACATGCTGGCTGCAGCTGG + Exonic
998349295 5:141490595-141490617 GTAAAGCTGCTGGTTGAAGCGGG - Exonic
998471070 5:142384154-142384176 GTAAAGCTGCTGGCTGCATTTGG + Intergenic
998681104 5:144468247-144468269 ACAAAGATAGTGGCTGCAGGAGG - Intronic
999799601 5:155020238-155020260 GCCATCATGCCGGCTGCAGCAGG - Intergenic
999887320 5:155937269-155937291 GCCAAGATGCTGGCTGCAGTGGG - Intronic
1000081695 5:157854468-157854490 GCAAACATGCACACTGCAGCTGG - Intronic
1000249436 5:159480062-159480084 GCAAAAATTCTGGCTGAAGCTGG + Intergenic
1000426081 5:161093258-161093280 GCCATCATGCTGGCTGCAGCAGG + Intergenic
1000854381 5:166379954-166379976 GTGAAGAGGCAGGCTGCAGCGGG - Intergenic
1002076006 5:176708904-176708926 GCAAAGACCCTGACAGCAGCGGG - Intergenic
1002678157 5:180935785-180935807 GTGAAGATGCTGGCTGCAGCAGG - Intronic
1004251481 6:14026498-14026520 GCAGAGATGCTGGCCCCAGTAGG + Intergenic
1004322001 6:14639213-14639235 GCCAGGAAGCAGGCTGCAGCAGG - Intergenic
1005043589 6:21620864-21620886 GCCATCATGCTGGCTGCAGCAGG - Intergenic
1005366851 6:25087054-25087076 GGAAAGATGCTAAGTGCAGCAGG + Intergenic
1006463934 6:34179663-34179685 GAAAAGACTCTGGCTGCAGTGGG - Intergenic
1006892308 6:37439414-37439436 CCAAAGCAACTGGCTGCAGCAGG - Intronic
1007649812 6:43412559-43412581 GCCAAGATGCCAGCTGCAGCAGG + Intergenic
1009241601 6:61192751-61192773 CCAAGCATGCTGACTGCAGCAGG + Intergenic
1009505015 6:64467548-64467570 GCACAGATGCCAGCTGTAGCAGG - Intronic
1009530348 6:64804058-64804080 GCAAAGACACTGGCTGCAGTAGG - Intronic
1010489274 6:76453689-76453711 GCAAAGACACTGGCTACAGCAGG - Intergenic
1010519573 6:76817404-76817426 GCCATGATGCTGGCTGCAGTGGG + Intergenic
1011795320 6:90947059-90947081 GCCATCACGCTGGCTGCAGCCGG + Intergenic
1012709439 6:102581445-102581467 GCAAAGACACTGGCTGCAGTGGG + Intergenic
1012889794 6:104885398-104885420 GCAAAGACGCCGGCTACAGCGGG + Intergenic
1013086917 6:106864599-106864621 GCCAAGATGCTGGCTGCAGTGGG - Intergenic
1013393680 6:109713226-109713248 GAAAGCATGGTGGCTGCAGCAGG + Intronic
1013438481 6:110138135-110138157 CCAAGCATGCTGGCTGCAGTGGG + Intronic
1013438718 6:110139403-110139425 GCAAAGATGCTGGCTGCAACGGG - Intronic
1014662705 6:124193345-124193367 CCAGGTATGCTGGCTGCAGCAGG + Intronic
1014703347 6:124716234-124716256 GCAAAGTTGGTGGGTGCAGTAGG - Intronic
1015464422 6:133532992-133533014 GAAAGGATGCTGGTTTCAGCTGG - Intergenic
1016076897 6:139805724-139805746 GCGAAGATGCCAGCTGCAACAGG - Intergenic
1016163454 6:140908795-140908817 GCAAAGACACTGGTTGCAGCAGG - Intergenic
1017054319 6:150424183-150424205 GCCATCATGCTGGCTGCAGCAGG + Intergenic
1017522506 6:155214231-155214253 GCGATGATGCCGGCTGCACCGGG - Intronic
1017780684 6:157713191-157713213 GCAAATATGCTGACTGCAAAAGG - Intronic
1019603414 7:1896342-1896364 GCTGAGATGCTGGCTCGAGCAGG + Intronic
1019739647 7:2666221-2666243 GCAAAGCTGCTGGTGGCAGGAGG - Intergenic
1020761017 7:12268915-12268937 GCCATCATGCTGGCTTCAGCAGG + Intergenic
1020959569 7:14786460-14786482 GCAAAAGAGCTGGCTGCAGTGGG + Intronic
1021182197 7:17519777-17519799 CAAAAGATGCTAGCTGCTGCTGG - Intergenic
1021194426 7:17659424-17659446 GCATAAAAGCAGGCTGCAGCAGG + Intergenic
1021343258 7:19489691-19489713 GTGAAGACTCTGGCTGCAGCAGG - Intergenic
1021431285 7:20560830-20560852 GCAAAGACACTGTCTGCAGCTGG - Intergenic
1021561575 7:21972754-21972776 GCCATCATTCTGGCTGCAGCAGG - Intergenic
1021800108 7:24296558-24296580 GTAAAGATGGTGGATGCGGCCGG + Intergenic
1022391755 7:29949976-29949998 GTGAAGATGCCGGCTGCAACAGG + Intronic
1022533879 7:31083907-31083929 GCAGGGATGCTGGATTCAGCTGG + Intronic
1022742630 7:33137492-33137514 GCGAAGACACTGGCTGCAGCGGG - Intronic
1022889605 7:34682880-34682902 GCAAAGATGCTGCCTCCAAGTGG + Intronic
1023120140 7:36900911-36900933 GGAAAGATTCTGCCTGCAGAGGG + Intronic
1023497565 7:40815051-40815073 CCAACCATGTTGGCTGCAGCTGG - Intronic
1024024411 7:45399151-45399173 GCGAAGATGCTGGCTGCAGTGGG + Intergenic
1024460808 7:49657490-49657512 GCAAAGAAACTGGCTGGAACTGG + Intergenic
1024517014 7:50267690-50267712 GCAAAGAGTCTGGCTGCAGGAGG + Intergenic
1024786363 7:52911717-52911739 GCCATGATGCTGGCTGCAGTGGG - Intergenic
1025018673 7:55463836-55463858 ACATAGATGCAGGCTACAGCAGG + Intronic
1026392164 7:69912444-69912466 GCCAAGATGCTGGCTGCAGCCGG - Intronic
1027687513 7:81295442-81295464 GCCAAGATGCTGGCTGCAGCGGG - Intergenic
1027911686 7:84260318-84260340 GCAAGGATGCCAGCTGCAGGAGG + Intronic
1028053221 7:86209331-86209353 GCAAAGAGACTGGCTGCAGTGGG - Intergenic
1028088901 7:86672730-86672752 GCTAAGGTTCTGGCTGGAGCTGG - Intronic
1028595994 7:92546885-92546907 GCAAAGGTGCCAGCTGCAGCAGG + Intergenic
1029327484 7:99822902-99822924 GCCATTACGCTGGCTGCAGCAGG + Intergenic
1029781906 7:102743884-102743906 GCCATCACGCTGGCTGCAGCAGG + Intergenic
1029973953 7:104815254-104815276 GCCATCATGCCGGCTGCAGCAGG - Intronic
1030721813 7:112880872-112880894 GCAAAGACACTGGCTGCAGCAGG + Intronic
1031746648 7:125506506-125506528 CCAAAGATGCTCTCTGCACCAGG + Intergenic
1031922106 7:127609548-127609570 GTGAAGATGCTGGCTGCAGATGG - Intergenic
1032591336 7:133194482-133194504 GTGAAAATACTGGCTGCAGCGGG - Intergenic
1032919386 7:136528054-136528076 GTAAAGATGCCAGCTGCAGCAGG - Intergenic
1035454709 7:159000409-159000431 GCACAGATTCTGGCTGCCTCTGG - Intergenic
1037554099 8:20004948-20004970 GCCATCATGCTGGCTGCAGCAGG - Intergenic
1038758060 8:30360304-30360326 CCATAGGTGCTGGCTGCTGCTGG - Intergenic
1039829723 8:41203549-41203571 GAAAAGATGCTAGATGCATCTGG - Intergenic
1040559706 8:48513810-48513832 GCAAAGATGCTGGAGGCCACTGG - Intergenic
1041274274 8:56141906-56141928 GCCATGACACTGGCTGCAGCAGG + Intergenic
1041743994 8:61186235-61186257 AAAAAGGTGCTGTCTGCAGCTGG + Intronic
1042004700 8:64168513-64168535 GCCACCATGCAGGCTGCAGCAGG + Intergenic
1042643222 8:70957046-70957068 GTGAGGATGCTGGCTGCAGCGGG - Intergenic
1043734346 8:83724741-83724763 GCCAAGACACTGGCTGCAGTGGG - Intergenic
1043735164 8:83731569-83731591 GCCAAGATACCGGCTGCAGCTGG - Intergenic
1043756191 8:84006119-84006141 GCAAAGACGCCAGCTGCAGCGGG - Intergenic
1044528829 8:93284490-93284512 GAAAAGATGCTTGATGCACCTGG - Intergenic
1045782729 8:105886696-105886718 GCCATGATGCTGGCTGCAGTGGG + Intergenic
1045806014 8:106162680-106162702 GCAGAGATAATGGCTGGAGCTGG + Intergenic
1046195588 8:110859943-110859965 GCAAAGATACCAGTTGCAGCAGG + Intergenic
1046407419 8:113791506-113791528 GCCGTGATGCTGGCTGCAGTGGG - Intergenic
1047104816 8:121720461-121720483 GCCAAGATGCCAGCTGCAGCGGG - Intergenic
1047789423 8:128187433-128187455 GCAGAGCTGATGGCAGCAGCTGG + Intergenic
1048238401 8:132715978-132716000 GCAAAGACGCCAGCTGCAGCAGG + Intronic
1049225555 8:141448955-141448977 GACAAGCTGCTGCCTGCAGCAGG - Intergenic
1049823840 8:144654569-144654591 GCCATCACGCTGGCTGCAGCAGG + Intergenic
1049826989 8:144675147-144675169 GCCATGACGCTGGTTGCAGCTGG - Intergenic
1050941853 9:11471076-11471098 GCAAAGATGCTGGCTGCAGCAGG + Intergenic
1051783894 9:20721413-20721435 GGAAAGATGCTGGATGCAGTGGG + Intronic
1052466935 9:28840306-28840328 GCAAAGATGCCGGCTGCAGCAGG - Intergenic
1052652524 9:31321977-31321999 GCCAAGAGGGTGGCTGCAGCAGG - Intergenic
1052852561 9:33386883-33386905 GCAAAGAAGCTGGCTGAGGCGGG + Intronic
1053076388 9:35138275-35138297 GCCATCATGCTGGCTGCAGCAGG + Intergenic
1053077901 9:35150694-35150716 GCCATCATGCTGGCTGCAGCAGG + Intergenic
1053444935 9:38145759-38145781 GCCATGATACTGGCTGCAGTGGG + Intergenic
1053614054 9:39745138-39745160 GCCAAGATGCCGGCTGCAGCAGG - Intergenic
1053680661 9:40483434-40483456 GCAAAGGAGCTGGCTGAGGCGGG + Intergenic
1053872083 9:42503076-42503098 GCCAAGATGCCGGCTGCAGCAGG - Intergenic
1053900669 9:42792884-42792906 GCCAAGATGCTGGCTGCAGCAGG + Intergenic
1053930647 9:43111746-43111768 GCAAAGGAGCTGGCTGAGGCAGG + Intergenic
1054239462 9:62597255-62597277 GCCAAGATGCCGGCTGCAGCAGG + Intergenic
1054260978 9:62864658-62864680 GCCAAGATGCCGGCTGCAGCAGG - Intergenic
1054283052 9:63141501-63141523 GCAAAGGAGCTGGCTGAGGCGGG - Intergenic
1054293743 9:63318949-63318971 GCAAAGGAGCTGGCTGAGGCGGG + Intergenic
1054391767 9:64623438-64623460 GCAAAGGAGCTGGCTGAGGCGGG + Intergenic
1054503960 9:65892890-65892912 GCAAAGGAGCTGGCTGAGGCGGG - Intronic
1054553594 9:66631782-66631804 GCCAAGATGCCGGCTGCAGCAGG + Intergenic
1055572494 9:77631824-77631846 GCCATCATGCCGGCTGCAGCAGG + Intronic
1055816403 9:80212464-80212486 GCAAATATGCCAGCTGCAGCAGG + Intergenic
1055891038 9:81123246-81123268 GCCATGATGCTGGCTTCAGTGGG - Intergenic
1057510951 9:95679014-95679036 GCCAGGACACTGGCTGCAGCAGG - Intergenic
1058077546 9:100666832-100666854 GCAAAGATGCCAGCTGTGGCAGG + Intergenic
1059461242 9:114431773-114431795 GCAAAGATGCTGTATCCATCGGG + Intronic
1059681397 9:116590055-116590077 GCAAAGACACCGGCTGCAGCAGG + Intronic
1060845152 9:126831052-126831074 GCTAAAATTCTGGCAGCAGCTGG + Intronic
1061022501 9:128025381-128025403 GCAAGGATGTTCCCTGCAGCTGG - Intergenic
1061507176 9:131038000-131038022 GCCATGAGGCTGGCTGCAGACGG - Intronic
1062205981 9:135337658-135337680 GTAGCAATGCTGGCTGCAGCAGG + Intergenic
1062434497 9:136540836-136540858 GCTAAGATGTTGGCTGCTGACGG - Intronic
1062528700 9:136990075-136990097 TCTGAGATGCTGGCTGTAGCAGG - Intergenic
1203546854 Un_KI270743v1:134661-134683 GCAAAGAAGCTGGCTGCATGGGG - Intergenic
1188434741 X:30147991-30148013 GCCATGATGCTTGCTGCAGTGGG + Intergenic
1190360714 X:49645583-49645605 GCCAAGGTGCTGGCTACAGCCGG - Intergenic
1190998644 X:55636923-55636945 GCCATCATACTGGCTGCAGCAGG + Intergenic
1191016224 X:55813262-55813284 GTGAACATTCTGGCTGCAGCAGG + Intergenic
1191221064 X:57989280-57989302 GCCATCATGCTGGCTGCAGCAGG + Intergenic
1192265475 X:69534371-69534393 GCCAAGATGTCGGCTGCAGCAGG - Intergenic
1192356120 X:70405715-70405737 GCCAAGTTGCTGGCAGCAGATGG - Intronic
1194379191 X:93174429-93174451 GCCATCATGCTGGCTGTAGCAGG + Intergenic
1194782409 X:98040761-98040783 GCAAAGATGATGGTTACATCAGG + Intergenic
1195179245 X:102340184-102340206 GCCATCATGCTGGCTGCAGCAGG - Intergenic
1195692692 X:107640932-107640954 GCAAATATGCTATCTGTAGCAGG + Exonic
1195880431 X:109586918-109586940 GCGAAGATGCTGGCTGCAGCAGG - Intergenic
1196883854 X:120224212-120224234 GCAATCATGCTGGCTGCAGCAGG - Intergenic
1197035509 X:121869865-121869887 GCAAAGGTGCTAGCTGCAGTGGG + Intergenic
1197342077 X:125286998-125287020 GCCATGATGCTGGCTACAGTGGG + Intergenic
1197378230 X:125709115-125709137 GCAAAGTTACGGGCTGCAGTGGG + Intergenic
1198189349 X:134287506-134287528 GCAAAGATGCCAGCTGCAGTGGG + Intergenic
1198548550 X:137719921-137719943 ACACAGTTGCTAGCTGCAGCAGG + Intergenic
1198699631 X:139382813-139382835 GCCATCATTCTGGCTGCAGCAGG - Intergenic
1199861248 X:151801812-151801834 GCCATCACGCTGGCTGCAGCAGG - Intergenic
1199862833 X:151817252-151817274 GCAGAGATAATGGCTGAAGCTGG - Intergenic
1200303629 X:155003660-155003682 CCAAAGAAGATGGATGCAGCTGG + Intronic
1200551052 Y:4578498-4578520 GCCATCATGCCGGCTGCAGCAGG - Intergenic