ID: 1085496847

View in Genome Browser
Species Human (GRCh38)
Location 11:76978122-76978144
Sequence CACCATCAATGTATGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085496847_1085496856 10 Left 1085496847 11:76978122-76978144 CCATGGGCCATACATTGATGGTG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1085496856 11:76978155-76978177 GACAGGTTCCTGGGCAGAAAGGG 0: 15
1: 76
2: 162
3: 283
4: 595
1085496847_1085496859 21 Left 1085496847 11:76978122-76978144 CCATGGGCCATACATTGATGGTG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1085496859 11:76978166-76978188 GGGCAGAAAGGGGCAGTCCCCGG 0: 1
1: 1
2: 8
3: 69
4: 447
1085496847_1085496855 9 Left 1085496847 11:76978122-76978144 CCATGGGCCATACATTGATGGTG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1085496855 11:76978154-76978176 AGACAGGTTCCTGGGCAGAAAGG 0: 28
1: 114
2: 167
3: 306
4: 724
1085496847_1085496853 0 Left 1085496847 11:76978122-76978144 CCATGGGCCATACATTGATGGTG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1085496853 11:76978145-76978167 GCAGGAGGCAGACAGGTTCCTGG 0: 48
1: 189
2: 278
3: 267
4: 691
1085496847_1085496852 -7 Left 1085496847 11:76978122-76978144 CCATGGGCCATACATTGATGGTG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1085496852 11:76978138-76978160 GATGGTGGCAGGAGGCAGACAGG 0: 41
1: 78
2: 143
3: 252
4: 808
1085496847_1085496857 11 Left 1085496847 11:76978122-76978144 CCATGGGCCATACATTGATGGTG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1085496857 11:76978156-76978178 ACAGGTTCCTGGGCAGAAAGGGG 0: 13
1: 66
2: 149
3: 256
4: 546
1085496847_1085496854 1 Left 1085496847 11:76978122-76978144 CCATGGGCCATACATTGATGGTG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1085496854 11:76978146-76978168 CAGGAGGCAGACAGGTTCCTGGG 0: 60
1: 203
2: 325
3: 426
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085496847 Original CRISPR CACCATCAATGTATGGCCCA TGG (reversed) Intronic
900248018 1:1648304-1648326 CACACTCAATGTCTGGCACAGGG + Intronic
900259243 1:1715455-1715477 CACACTCAATGTCTGGCACAGGG + Intronic
901648314 1:10728339-10728361 CACCATCATTTTATGGACCACGG + Intronic
911537278 1:99115484-99115506 CATCATCAATGTATGTCAAAAGG + Intergenic
911860507 1:102941685-102941707 CACCATCAATGCCTTGTCCAAGG + Intronic
917828146 1:178845906-178845928 CACTAACAATGTAAGGCACAAGG - Intronic
920508660 1:206534808-206534830 CAGCATCAATGTCTGGAGCATGG - Intronic
920617137 1:207504819-207504841 CAGTATCAGTCTATGGCCCAGGG - Intronic
921294581 1:213689886-213689908 TACACTCAATGTATGGTCCAGGG + Intergenic
1063056259 10:2507574-2507596 CACAATCAATGTATCTCCCTCGG - Intergenic
1068502149 10:57853613-57853635 CACCATGAATATATGCACCAAGG - Intergenic
1071021653 10:81064341-81064363 CACCAGCCATATTTGGCCCATGG - Intergenic
1073573683 10:104602535-104602557 CAACGTCAATGTCTGGCCAATGG + Intergenic
1073707523 10:106001847-106001869 CACCAGCATTCTGTGGCCCATGG - Intergenic
1076630507 10:131849365-131849387 CACCCTCAATGTAGCGCCCAGGG - Intergenic
1079318889 11:19433380-19433402 CACCAACAAGGTAAAGCCCAAGG + Intronic
1081890372 11:46536652-46536674 CTCCATCAATGTTTGGGCCGAGG + Intronic
1085496847 11:76978122-76978144 CACCATCAATGTATGGCCCATGG - Intronic
1088754415 11:112873851-112873873 CACCAGCAGTGAATTGCCCAGGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089691565 11:120189966-120189988 CAGCATAAATGGCTGGCCCAGGG - Intergenic
1095543260 12:43335833-43335855 CACCTTCATTGTATGGCAAATGG - Intergenic
1097224043 12:57466438-57466460 CTCCTTCAAGGTAGGGCCCAAGG + Intronic
1108522530 13:51259022-51259044 CACCAGACATCTATGGCCCAGGG - Intronic
1110959498 13:81603498-81603520 CACCCTCTATGTATAGACCAAGG + Intergenic
1114485710 14:23060307-23060329 CACCATCCATGCCTGGCCCTTGG + Intronic
1115333827 14:32225605-32225627 CACCATAACTGCATGCCCCAAGG - Intergenic
1119636090 14:76274609-76274631 TACAGCCAATGTATGGCCCAGGG - Intergenic
1121462969 14:94096208-94096230 CAACAGCCTTGTATGGCCCATGG - Intronic
1121942045 14:98080332-98080354 CTCCAGCTATGTATGGCCCATGG + Intergenic
1122906360 14:104803400-104803422 GACCGTCAAGGTAAGGCCCACGG - Exonic
1124371822 15:29108418-29108440 CACCACCACTGCAGGGCCCAGGG + Intronic
1131005781 15:88976950-88976972 TACAATCAAAGTATTGCCCAGGG - Intergenic
1131314109 15:91317605-91317627 CAAGATCAATGTCTGGCACAGGG - Intergenic
1132282736 15:100634198-100634220 CATAGTCAATGTATGGACCAGGG + Intronic
1133534853 16:6691930-6691952 CACCAACAGTCCATGGCCCATGG - Intronic
1133541588 16:6760822-6760844 CACCAACAGTGTGTGGCCCCAGG + Intronic
1138738538 16:59280407-59280429 CAGCAACAATGGCTGGCCCATGG - Intergenic
1140273950 16:73492023-73492045 AACCATCAATGAAGGGACCAAGG - Intergenic
1141500757 16:84442734-84442756 CACCACCAACAGATGGCCCAAGG - Intronic
1145746390 17:27323350-27323372 CATAATCACAGTATGGCCCAGGG + Intergenic
1148884707 17:50763858-50763880 CACCTGCTATGTATTGCCCAAGG - Intergenic
1153519766 18:5940634-5940656 CACCATAAATGCATGGTTCAGGG + Intergenic
1167694503 19:51006850-51006872 CATCATCTATGTCTGGCCCAGGG + Intronic
1168568098 19:57441151-57441173 CATCATCAATGCCTAGCCCAGGG - Intronic
925801378 2:7605221-7605243 CACTACCAATCCATGGCCCAGGG + Intergenic
926412542 2:12619657-12619679 CACCATCATTTTATGCACCATGG - Intergenic
927479039 2:23435828-23435850 CCCCAGCAATGAATGGCCCCAGG + Intronic
927999214 2:27508055-27508077 CACCAGCAAGGTCTGACCCACGG - Exonic
931627429 2:64269471-64269493 CATCATTCATGTAAGGCCCATGG - Intergenic
935100180 2:99987078-99987100 GACCATCAATGCATGAACCAGGG + Intronic
936043640 2:109169368-109169390 CACCATCATAGTATGGAGCAAGG - Intronic
937797268 2:126038612-126038634 CAGCATAAATGTATTGCACATGG + Intergenic
943655864 2:190508329-190508351 CACCAACATTGTGAGGCCCATGG + Exonic
1172917429 20:38453502-38453524 CGCCATCACTGCATGGACCATGG + Intergenic
1180993691 22:19953940-19953962 CACCATGCAGGTCTGGCCCATGG + Intronic
953455422 3:43036863-43036885 TACAATCAAGGTATGGACCAGGG - Intronic
954682544 3:52353507-52353529 CAACATCAATGTCAGGCCCAAGG + Exonic
955753645 3:62206529-62206551 CACCATCATTGTGTGGCACCTGG - Intronic
959008294 3:101045345-101045367 CACTATCCATGTAAGACCCAGGG - Intergenic
961069346 3:123907359-123907381 CACAATCTATGTAAAGCCCATGG + Intronic
963190639 3:142468548-142468570 AAACATTAATGAATGGCCCAAGG + Intronic
963890531 3:150631551-150631573 CACCACCAGTCCATGGCCCAAGG - Intergenic
966437651 3:179906479-179906501 CAGCCTCAATGTAAGGCCAAAGG - Intronic
966573855 3:181477449-181477471 AACCATCAATGCATGTCCCTAGG - Intergenic
977586903 4:98784261-98784283 CTCCACCAAATTATGGCCCAGGG + Intergenic
980202598 4:129675662-129675684 CACCCTCAATGTGGGGTCCAGGG + Intergenic
982391357 4:154867682-154867704 CACAATCAATGTAAGGACAAAGG + Intergenic
983700138 4:170581665-170581687 CAGTATCAGTCTATGGCCCAGGG + Intergenic
986591160 5:9372452-9372474 CTCCATGTATGTATGTCCCATGG - Intronic
990163061 5:52964534-52964556 CACCATCATGGTATTCCCCATGG - Intergenic
997726469 5:136124744-136124766 TTCCATCAATGTATTGACCATGG + Intergenic
1013543112 6:111131334-111131356 AACACTCACTGTATGGCCCAAGG + Intronic
1014496435 6:122129564-122129586 CACCATCTATCTATGCCCCCAGG - Intergenic
1016935804 6:149448762-149448784 TAACATCACTGTATGCCCCAGGG + Intronic
1018612523 6:165660208-165660230 CACCTTCAATGCATGGCCAAAGG + Intronic
1022942350 7:35253371-35253393 CACCCGCGATGTATGGCTCATGG + Intronic
1024467497 7:49727938-49727960 CTCCAGCAATGTATGCCACAGGG + Intergenic
1027412911 7:77941516-77941538 CATCAACAATGAATGGCACATGG - Intronic
1031049672 7:116932250-116932272 AACAATCTATGTATGGCCCATGG + Intergenic
1033112246 7:138590481-138590503 CACCATCAAAGTTTGGCACTTGG - Intergenic
1041814437 8:61952319-61952341 CTCCATCTATGTGTGGCACAAGG + Intergenic
1043326355 8:79056580-79056602 CACAATCACTGGATGTCCCATGG + Intergenic
1043965376 8:86469030-86469052 CACCACCAGTAAATGGCCCAGGG + Intronic
1043988632 8:86724504-86724526 CTACATCAATGTCTGGCACATGG - Intronic
1045686315 8:104715937-104715959 TACCATCAAAGTATTGGCCAAGG - Intronic
1045886479 8:107104272-107104294 CATCATCAACTCATGGCCCAGGG - Intergenic
1048087390 8:131198369-131198391 CCCCAGCAATGCATGGCCCTTGG - Intergenic
1052538952 9:29781778-29781800 CTCCATTCATGTATGGTCCAGGG + Intergenic
1057265434 9:93614295-93614317 CACCCTCTATGTCTGCCCCAGGG - Intronic
1060797581 9:126522955-126522977 CACCATCAGTGGATGGAGCAGGG - Intergenic
1061746853 9:132746409-132746431 CACCAGGAATGCATGGCCAAGGG + Intronic
1186446778 X:9636521-9636543 CAACAACCATGTATGGTCCAGGG + Intronic
1191057540 X:56257954-56257976 CTCAATCATTGTTTGGCCCATGG + Intronic
1192262897 X:69518175-69518197 CATCATCACTGTCTGGACCATGG - Intronic
1200850793 Y:7881099-7881121 CACCATTAATGCAGGGCCAAGGG + Intergenic