ID: 1085499997

View in Genome Browser
Species Human (GRCh38)
Location 11:77011463-77011485
Sequence CAGAAGCCTTCACTGTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 161}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085499993_1085499997 -8 Left 1085499993 11:77011448-77011470 CCTGGCCCACACTGCCAGAAGCC 0: 1
1: 0
2: 3
3: 45
4: 326
Right 1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 161
1085499987_1085499997 26 Left 1085499987 11:77011414-77011436 CCCCCACTGATCATATTCCTGTC 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 161
1085499992_1085499997 9 Left 1085499992 11:77011431-77011453 CCTGTCATATTTCAGTACCTGGC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 161
1085499986_1085499997 30 Left 1085499986 11:77011410-77011432 CCTACCCCCACTGATCATATTCC 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 161
1085499988_1085499997 25 Left 1085499988 11:77011415-77011437 CCCCACTGATCATATTCCTGTCA 0: 1
1: 1
2: 2
3: 14
4: 175
Right 1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 161
1085499989_1085499997 24 Left 1085499989 11:77011416-77011438 CCCACTGATCATATTCCTGTCAT 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 161
1085499990_1085499997 23 Left 1085499990 11:77011417-77011439 CCACTGATCATATTCCTGTCATA 0: 1
1: 0
2: 1
3: 8
4: 193
Right 1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085499997 Original CRISPR CAGAAGCCTTCACTGTGTTG AGG Intronic
900414496 1:2528728-2528750 CAGCAGACGACACTGTGTTGGGG + Exonic
900993761 1:6109506-6109528 CAGAAGCCTTTACAGTTTCGTGG + Intronic
901719660 1:11186394-11186416 CAAAAGACTTCACAGTGTTTGGG - Intronic
904428456 1:30446748-30446770 CAGAACCCTTCACCCTGTCGTGG - Intergenic
904698704 1:32345588-32345610 CAGAAGCCCAGAGTGTGTTGTGG - Intergenic
905163232 1:36055847-36055869 CAGAAACCAACACTGTGTGGGGG + Exonic
907457525 1:54585102-54585124 TGGAAGGCTGCACTGTGTTGAGG - Intronic
907491092 1:54809292-54809314 CAGAAGCATTCCCAGTGGTGAGG - Intronic
907597755 1:55735350-55735372 CCAGAGCCTTCACTGTGCTGAGG + Intergenic
907626231 1:56032755-56032777 CAGAAGCCTTGTCTGTGTCTTGG - Intergenic
907786108 1:57614473-57614495 ATGAAGCTTTCACTGTTTTGTGG + Intronic
908164635 1:61446308-61446330 CAGAAGCCTTCCAGGGGTTGTGG + Intronic
908532304 1:65045451-65045473 CAAAAACCTTCTCTGTGATGTGG + Intergenic
909905971 1:81195446-81195468 AAGAAGCCATCACTGTTTTGAGG - Intergenic
911289239 1:96036289-96036311 CATACTCCTTCACTGTGTTCTGG + Intergenic
915125324 1:153659615-153659637 CAGTGGCTTTCACTGTGTTGAGG - Intronic
917667392 1:177238448-177238470 GAGAAGCCATCACTGGATTGTGG + Intronic
918863258 1:189860460-189860482 CAGAAGCCTTCAATCTGTCCTGG - Intergenic
921927111 1:220719913-220719935 CAGATGCCTTCAATCTGTAGCGG + Intergenic
923708969 1:236370010-236370032 CAGAAGCCATGACTGTGTCTTGG - Intronic
1064116235 10:12579753-12579775 TAGATGCCTTCACTGTGATGGGG + Intronic
1064366867 10:14716306-14716328 CTGAAGGCTCCACTGGGTTGCGG + Intronic
1067296379 10:44977369-44977391 CAGAAGCCTTTACTGGGGAGGGG + Exonic
1067406064 10:46024461-46024483 CTGAAGACTTTACTGTGCTGGGG - Intronic
1067822718 10:49544013-49544035 CAGAAGGCATCACTATGGTGAGG + Intergenic
1070806074 10:79271504-79271526 CAGCAGCCTTCACAGTGTTCTGG + Intronic
1071287016 10:84158313-84158335 CAGAAGCCTTTACTGTGGGTGGG + Intergenic
1072636393 10:97181226-97181248 CAGAGGCCTGCGCTGTGTAGGGG - Intronic
1073375080 10:103026718-103026740 CAAAAGCATTCAGTGTGCTGTGG + Intronic
1077888713 11:6403937-6403959 CAGAAGCAGGAACTGTGTTGTGG - Intronic
1078172751 11:8941439-8941461 CAGCAGGCTGCACTGTGTAGTGG + Intergenic
1078596619 11:12692724-12692746 CTGAAGCCTCCACTATGTTAGGG - Intronic
1079208850 11:18442521-18442543 CAGAATCCTTCACAATGTTTTGG + Intronic
1081560993 11:44216384-44216406 CAGATTCCTTCACTTTCTTGCGG + Intronic
1084003696 11:66312555-66312577 CAGAGGTCTTAACTCTGTTGGGG - Intergenic
1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG + Intronic
1088698515 11:112390975-112390997 GAGAAGGCTTCACTGAGATGAGG - Intergenic
1090126757 11:124094178-124094200 CACAGGCCATCACTGTGTAGAGG + Intergenic
1094094343 12:26687178-26687200 CAGAAGCCTTCATAGTGATGTGG + Intronic
1095614463 12:44171929-44171951 CAAATGCCTTCACCGTCTTGGGG - Intronic
1095940295 12:47722604-47722626 GAGCAGTCTTCCCTGTGTTGTGG + Intronic
1100451769 12:94713405-94713427 CAGCAGCTGTCACTGTGTGGTGG - Intergenic
1101548660 12:105741029-105741051 CAGCTGCCTTTTCTGTGTTGGGG - Intergenic
1106009413 13:25804570-25804592 CAGAAAGCTCCACTGTGTAGAGG - Intronic
1107398139 13:40039952-40039974 CAGAAAATTTTACTGTGTTGTGG - Intergenic
1108439296 13:50433529-50433551 CAGTGGGCTTTACTGTGTTGAGG + Intronic
1110666094 13:78118949-78118971 CTGAGGTCTTCCCTGTGTTGTGG - Intergenic
1112781061 13:102901938-102901960 CAGAAGCCCTCACTGTGCCCTGG - Intergenic
1113114368 13:106859388-106859410 CAGAAACCTTCTCTGTGGTGGGG + Intergenic
1113567739 13:111328884-111328906 CGGAAGCCTTCACGGGGATGGGG - Intronic
1113845802 13:113390587-113390609 CAGAAGGCATCAGTGTGGTGAGG - Intergenic
1113956711 13:114103282-114103304 GGGCAGCCTTCACTGTGCTGAGG - Intronic
1115404573 14:33000029-33000051 GAGAACCCTTCACTCTGCTGGGG + Intronic
1115611243 14:35050615-35050637 GAGAAGCCTCTACTGTCTTGGGG + Intronic
1116783143 14:49258572-49258594 CAGAAGCCTTGACTGAAGTGAGG - Intergenic
1118764289 14:68899692-68899714 CTGAAGCCTTCTCTGTGTCCTGG - Intronic
1120979753 14:90279308-90279330 CAGAAGCCACTGCTGTGTTGGGG + Intronic
1121113678 14:91329324-91329346 CAGAAGACTTCCCTGTGTTCAGG + Intronic
1121623075 14:95363594-95363616 GAAAATCCTTCACTGTGCTGGGG - Intergenic
1122074508 14:99227490-99227512 CAGAATCCTTCCCTGTTCTGAGG - Intronic
1122661554 14:103299155-103299177 AGGAAGGCTTCACTGTGTGGAGG - Intergenic
1124549944 15:30670659-30670681 AAGAAGCCTTCACAGGATTGAGG + Intronic
1126277266 15:46898408-46898430 CACATGCCTCCACTGTGTTTTGG - Intergenic
1128178811 15:65581728-65581750 CAGAAGGTTTTTCTGTGTTGGGG - Intronic
1129092901 15:73170515-73170537 CAGGAGCTTTCACTGTGTTCAGG + Intronic
1129123095 15:73414999-73415021 CAGGAGCCTCCACTGTGATGAGG - Intergenic
1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG + Intronic
1130702825 15:86202618-86202640 CAGAAGCTTTCATTATGTTGGGG + Intronic
1132638760 16:967356-967378 CAGAATCCCTCACTGTTTTATGG - Intronic
1132725099 16:1334973-1334995 CAAACGCCTTCAACGTGTTGGGG - Intronic
1135354187 16:21755969-21755991 CAGGAGCCTGAACTGTGTTCTGG + Intronic
1135452677 16:22572110-22572132 CAGGAGCCTGAACTGTGTTCTGG + Intergenic
1136376388 16:29867944-29867966 CCGAAGCCTTCAAAGTGTTCTGG + Intergenic
1138499828 16:57433705-57433727 CAGAAGACCTCACAGTGTAGTGG - Intronic
1138628816 16:58276977-58276999 CAGAAGCATACACTGTTTTTAGG - Intronic
1139288521 16:65836440-65836462 CAGAAGCCTTCACAGCCCTGGGG - Intergenic
1140355592 16:74303184-74303206 CAGAACCTTTAACAGTGTTGTGG - Intronic
1141362401 16:83408061-83408083 CAGAAGATTTAGCTGTGTTGGGG + Intronic
1143892815 17:10115532-10115554 GAGAGGCCTTCTCTGTGCTGAGG - Intronic
1145202071 17:20954856-20954878 GAGAAGCCTACACTCTGCTGAGG - Intergenic
1146539917 17:33685370-33685392 CAGAAGCCTTCTGGCTGTTGAGG - Intronic
1147993523 17:44349436-44349458 CAGATGCCTGCTCAGTGTTGTGG - Exonic
1151750380 17:76033871-76033893 CAGCAGCCCACACTGTCTTGGGG + Intergenic
1154960520 18:21303907-21303929 CAGAAGCTGACACTGTGTTGGGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157403298 18:47403835-47403857 CAGAAGCCTTCTCACAGTTGGGG + Intergenic
1158083907 18:53626872-53626894 CAGCAGCCTAAACAGTGTTGGGG + Intergenic
1160658513 19:287439-287461 CAGCAGCCTTCACTCTTGTGGGG - Intronic
1164527171 19:29021000-29021022 GAGAAGGCTTCACTGTGCGGGGG - Intergenic
1164888883 19:31806156-31806178 AAGAAGCCTTTGCTGTGTGGAGG + Intergenic
1166778377 19:45326232-45326254 CAGAAGCCTTTTCTATGTTCGGG + Intergenic
1166889426 19:45981485-45981507 CAGAAGCCCACAGTGAGTTGGGG + Intergenic
927022501 2:19031704-19031726 CAGAAGCCATCACAGAGCTGTGG - Intergenic
929536254 2:42786227-42786249 CAGAGGTCTTCCCTGTGATGAGG + Intronic
933474068 2:82766456-82766478 CAGAAGCCAACACAGTGCTGGGG - Intergenic
934551019 2:95261692-95261714 CAGAATCCTCTACTGTGCTGAGG + Intergenic
937649394 2:124303100-124303122 CACCAGCTTCCACTGTGTTGTGG + Intronic
937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG + Intronic
938933977 2:136112541-136112563 CCAAAGCCTTCCCTGTGTCGTGG - Intergenic
940739613 2:157492500-157492522 CACAAGCCTGCACTGTATTTCGG - Intergenic
944463698 2:199979079-199979101 CACAAACCTTCACTGTGGGGAGG + Intronic
945413174 2:209536615-209536637 CAGAAGCCTTGTCTGTGTCTTGG + Intronic
948494102 2:238334786-238334808 CAGAAGCCTTTGCTGTCTTTTGG + Intronic
1169026945 20:2379641-2379663 CAGCAGCCTGCAGGGTGTTGAGG + Intergenic
1170174644 20:13454942-13454964 CAGAAGTCTTCACTTTGTGGTGG + Intronic
1173024858 20:39298487-39298509 CCGAAACCTTCTCTGGGTTGGGG + Intergenic
1173142808 20:40499042-40499064 CAGGAGCCTTTAATGAGTTGAGG - Intergenic
1174540557 20:51285993-51286015 CAGAAGCCTTTACTGTGGGGAGG - Intergenic
1176002690 20:62840097-62840119 CAGAGCCCTTCACTGAGATGAGG - Intronic
1177707112 21:24720612-24720634 CCAAAGCCTTCATTGTGATGAGG + Intergenic
1182462046 22:30490098-30490120 CTGGGGTCTTCACTGTGTTGGGG + Exonic
950609772 3:14118603-14118625 CAAAAGCCTCCAGTGGGTTGGGG - Intronic
950778985 3:15374909-15374931 CAGAACACTTCATTGTTTTGGGG - Intergenic
952208593 3:31205680-31205702 CAGAAGTCTTCATTTTGTTTTGG + Intergenic
953050528 3:39338173-39338195 CAGAAGCCTACACTTTTTTGAGG - Intergenic
953240571 3:41145108-41145130 CTGAAGCATTCACAGAGTTGGGG - Intergenic
953310363 3:41872035-41872057 AAGAAGCCTTCACAGGATTGAGG - Intronic
954322131 3:49839515-49839537 CAGAAGCACTGACTGTCTTGGGG - Intronic
955751106 3:62186222-62186244 CAGGAGCCTCAAATGTGTTGAGG - Intronic
958852234 3:99342065-99342087 CAGTAGGCTTCCCTGAGTTGAGG + Intergenic
961344638 3:126256157-126256179 CAGAAGCCTGCAGTGTGGAGGGG + Intergenic
962993175 3:140598324-140598346 CATGAGCCTTCACTGAGGTGTGG - Intergenic
964136293 3:153348459-153348481 CAGAAAGCTTAACTGTTTTGGGG - Intergenic
965006419 3:163032037-163032059 AAGAAGCCTACACTGTGAAGAGG - Intergenic
966578110 3:181526465-181526487 CACAAACCTTCACTTTCTTGAGG + Intergenic
969302012 4:6302622-6302644 CAGCAGCCTTCCCTTTGTCGGGG - Exonic
970036486 4:11741433-11741455 AAGAAGCATTCACTCGGTTGTGG - Intergenic
971114806 4:23632453-23632475 CAGAAGACTTCAGTATGTTGTGG - Intergenic
974254700 4:59434007-59434029 ATGTAGCCTTTACTGTGTTGAGG + Intergenic
974464232 4:62232952-62232974 CTGAAGCATTCACTGTGTCATGG - Intergenic
977658145 4:99547862-99547884 CAGTAGCCTTCATTGAGTTTGGG - Exonic
981580339 4:146243766-146243788 CAGAAGCCTTCTGTGTGTTCAGG + Intergenic
983814996 4:172113569-172113591 AAGCAGCATTCACAGTGTTGGGG - Intronic
986581161 5:9267228-9267250 CAGAAGCCTGCAAAGTGTGGCGG - Intronic
988449236 5:31323376-31323398 GAGAAGCCTTCACGGAGTAGTGG - Exonic
993385682 5:87260709-87260731 TAGAAGCAGTGACTGTGTTGGGG + Intergenic
995658904 5:114458969-114458991 CAGAGGCCATCACTCTCTTGGGG + Intronic
997714443 5:136031469-136031491 CAGTAGATCTCACTGTGTTGTGG - Intronic
997926284 5:138033356-138033378 CAGAAGCGATCTCTGTGTTCCGG - Intronic
1000313360 5:160065589-160065611 CAGAAGCCTTCTCTGGCTTTGGG + Intronic
1003140845 6:3469912-3469934 AAGAAGCCCTCACTGTCTAGGGG - Intergenic
1003159777 6:3625022-3625044 CAGGAGCCATAACTGAGTTGAGG + Intergenic
1003758083 6:9144946-9144968 CTGAAGGCCTCACTGGGTTGAGG + Intergenic
1003760798 6:9176738-9176760 CAGAAGCATTCACAGTATTAGGG + Intergenic
1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG + Intergenic
1013695052 6:112692193-112692215 CAGGAGCGTTCACTGTCTCGGGG + Intergenic
1013794986 6:113877681-113877703 CAAAAGCCATCCCTTTGTTGTGG - Intergenic
1014434744 6:121408947-121408969 CAGAACACTTCATTGTTTTGGGG + Intergenic
1017664241 6:156703786-156703808 CAGCAGCATTCCCTGTGCTGTGG - Intergenic
1019511548 7:1420002-1420024 CAGGAGCCTCCACTGTTTGGAGG - Intergenic
1024231145 7:47364627-47364649 CAAAAGCCTGCACAGTGTAGAGG - Intronic
1028980838 7:96966675-96966697 CAGTGGCCTTCACTGTCTGGAGG + Intergenic
1031411961 7:121450013-121450035 CAATTGCCTTCACTTTGTTGTGG - Intergenic
1031909387 7:127498981-127499003 CAGTCACCTTCACTGTCTTGGGG - Intergenic
1032662221 7:133997171-133997193 AAGAGGCCTTCACTGTCATGTGG - Intronic
1033534459 7:142299016-142299038 CTGAAGTCTCCACTGTGGTGTGG + Intergenic
1034072754 7:148202798-148202820 CAGAGGCTCTCACTGTGCTGGGG + Intronic
1034724533 7:153323108-153323130 CAGAGCCCTGCACAGTGTTGGGG + Intergenic
1036642583 8:10593383-10593405 CAACAGCCTTGATTGTGTTGGGG - Intergenic
1038014212 8:23499558-23499580 CAGAGGCCTTCACTGATTTGAGG - Intergenic
1038855001 8:31321321-31321343 CAGTGGCCTTCACTGGGTTGTGG + Intergenic
1039680482 8:39730235-39730257 CAGCAGCCATCACTGTGGCGAGG + Intergenic
1042062690 8:64838222-64838244 CAGAGGCCTTGAATGTCTTGCGG - Intergenic
1045598563 8:103686473-103686495 CAGATGCCTTTACTGTGCTAAGG + Intronic
1045710395 8:104976312-104976334 CAGGAGCCTTCAGTGGGCTGAGG - Intronic
1047023460 8:120802450-120802472 CAGCAGCCTACACTGTGGTCTGG + Intronic
1048193082 8:132308140-132308162 CAGAAGCCTTCCCAGGTTTGAGG + Intronic
1049351674 8:142167922-142167944 CAGAAGCTTTGAGTGCGTTGGGG - Intergenic
1049791566 8:144474833-144474855 CTGAAGCCCTCACTGGGTGGTGG + Exonic
1050051118 9:1602494-1602516 CAGAAGGCTTGTCAGTGTTGAGG - Intergenic
1051294187 9:15577511-15577533 AAGAGGCTTTCACTGTGTTCAGG + Intronic
1051605114 9:18910841-18910863 CAGCAGCCTTCATTGTCTTGTGG - Exonic
1051651928 9:19335335-19335357 CATATGCCTTCATTGTTTTGTGG + Intronic
1052455472 9:28691404-28691426 CAAGTGCATTCACTGTGTTGTGG - Intergenic
1055259943 9:74422217-74422239 TATAAGCATTCACTGTGTTCAGG - Intergenic
1056098770 9:83280420-83280442 CAAAAGCCCTGACTGTGTTTGGG + Intronic
1061418878 9:130462596-130462618 CACAAGCCGTCTTTGTGTTGGGG + Intronic
1190712389 X:53080129-53080151 CAGAAGCCATTACTTTGTGGGGG - Exonic
1192865023 X:75121858-75121880 CAGAAAGCATCAATGTGTTGAGG - Intronic
1195453057 X:105037343-105037365 AAGAATACTTCACTCTGTTGAGG - Intronic
1196098184 X:111821934-111821956 CACAACCCTTCAGAGTGTTGTGG + Intronic
1199810426 X:151343527-151343549 CACAAGCCTAAACTGTGGTGTGG + Intergenic