ID: 1085505028

View in Genome Browser
Species Human (GRCh38)
Location 11:77053510-77053532
Sequence TCCTGTGGATGCAGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085505028_1085505031 0 Left 1085505028 11:77053510-77053532 CCTGCTGGGCTGCATCCACAGGA No data
Right 1085505031 11:77053533-77053555 GCTTAGGCATTCTCAGTCACAGG No data
1085505028_1085505033 25 Left 1085505028 11:77053510-77053532 CCTGCTGGGCTGCATCCACAGGA No data
Right 1085505033 11:77053558-77053580 GAGATAGGAGATCAGTGTCTTGG No data
1085505028_1085505032 10 Left 1085505028 11:77053510-77053532 CCTGCTGGGCTGCATCCACAGGA No data
Right 1085505032 11:77053543-77053565 TCTCAGTCACAGGATGAGATAGG No data
1085505028_1085505034 26 Left 1085505028 11:77053510-77053532 CCTGCTGGGCTGCATCCACAGGA No data
Right 1085505034 11:77053559-77053581 AGATAGGAGATCAGTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085505028 Original CRISPR TCCTGTGGATGCAGCCCAGC AGG (reversed) Intergenic