ID: 1085507669

View in Genome Browser
Species Human (GRCh38)
Location 11:77069432-77069454
Sequence TCTTGGCTTTAGTGGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085507662_1085507669 2 Left 1085507662 11:77069407-77069429 CCTCTCCTATTGAAACGGAAGCC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1085507669 11:77069432-77069454 TCTTGGCTTTAGTGGGTGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 165
1085507663_1085507669 -3 Left 1085507663 11:77069412-77069434 CCTATTGAAACGGAAGCCTCTCT 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1085507669 11:77069432-77069454 TCTTGGCTTTAGTGGGTGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085507669 Original CRISPR TCTTGGCTTTAGTGGGTGAA GGG Intronic
905224557 1:36470779-36470801 TCTTGGCTTTCTTGGCAGAATGG + Intronic
905902764 1:41592643-41592665 TCTTGGCTTCTCTGGGGGAAGGG + Intronic
912620058 1:111146347-111146369 TTTGGGGTGTAGTGGGTGAAAGG - Intronic
914908831 1:151768577-151768599 TCCTGGCTTGGGTGGGTGGAGGG + Intronic
916079756 1:161225133-161225155 TCTTGGTCTTGGAGGGTGAAGGG - Intergenic
920054977 1:203185040-203185062 GCTTGGCTTAAATGGGTGGAGGG - Intronic
922504599 1:226119202-226119224 TCTTGGCTGTAGGTTGTGAAGGG - Intergenic
1065539724 10:26750604-26750626 TATTGACTTTACTGGGTTAACGG - Intronic
1067575842 10:47407797-47407819 TGTTGGCTATAGTGGGTATATGG + Intergenic
1067575898 10:47408317-47408339 TGTTGGCTATAGTGGGTATATGG + Intergenic
1067575909 10:47408419-47408441 TGTTGGCTATAGTGGGTATATGG + Intergenic
1067677233 10:48392266-48392288 TCTTGCCTTGAGCTGGTGAAAGG + Intronic
1068743002 10:60496199-60496221 TCTTGGGTTCAATGGGTGACTGG - Intronic
1071312225 10:84353609-84353631 TCCTGACTTAGGTGGGTGAATGG + Intronic
1071714423 10:88080982-88081004 TTATGGCTTTAATTGGTGAATGG + Intergenic
1072349364 10:94542676-94542698 TTTTGGCTTTAGTGTGTAACGGG - Intronic
1072464131 10:95647582-95647604 TCCTGCCTTGAGTAGGTGAAAGG - Intronic
1072723963 10:97800243-97800265 CCTGGGCTTTAGAGGGAGAAAGG + Intergenic
1077976124 11:7251155-7251177 TCTAGGCTTTACTGCTTGAAAGG + Intronic
1078017962 11:7631494-7631516 TCCTGGCTATAGGGGCTGAAGGG - Intronic
1079146045 11:17852894-17852916 TCTTCACTTTATTGGGTGAGTGG - Intronic
1080634634 11:34112873-34112895 TCTTGTCTTTTTTGGGAGAATGG - Intronic
1080913604 11:36631151-36631173 CCTTGGCTTCTGTGGGTGGAGGG - Intronic
1084541245 11:69788421-69788443 TCTTGGGGTTCGTGAGTGAATGG - Intergenic
1085507669 11:77069432-77069454 TCTTGGCTTTAGTGGGTGAAGGG + Intronic
1085917196 11:80903696-80903718 TCTTAGCTTTGGTGGTTTAATGG - Intergenic
1088239574 11:107759257-107759279 TCTTAGCTTTGGTGGCTTAATGG - Intergenic
1089493154 11:118895939-118895961 GCTTGGCTTGAGTGGGACAAGGG - Exonic
1091644521 12:2263738-2263760 TCTTGGCTTGAGTGAATGGAAGG + Intronic
1094505771 12:31059897-31059919 TTTTGCTTTTAGTTGGTGAAAGG + Intergenic
1094534642 12:31310185-31310207 TCTTTGCTTTAGTGGTTCATTGG - Intronic
1095172625 12:39053973-39053995 TCTGGGCTATAGTGAATGAAGGG + Intergenic
1100019170 12:90048917-90048939 TCTTGGATTTGGTGGGTGGGGGG + Intergenic
1100300539 12:93303546-93303568 TTTTGGCTATATTGGGTTAAAGG + Intergenic
1100641634 12:96487374-96487396 TGTTAGCTTTAGTGTGTGCAAGG + Intergenic
1103775132 12:123361819-123361841 TCTTCACTTTAGTTGCTGAAGGG - Intronic
1106580588 13:31014721-31014743 GGTTGGCTTTACTGGGTGGAAGG - Intergenic
1106885143 13:34176401-34176423 TCGTGGCTCTAGGGGGTGATGGG - Intergenic
1107293321 13:38882086-38882108 CCTTGGCTTTGGGAGGTGAATGG - Exonic
1112494328 13:99893619-99893641 CCTTGGCTTGAGGGGATGAAGGG + Exonic
1112777328 13:102859207-102859229 TCTGTCCTATAGTGGGTGAATGG - Intronic
1114814530 14:25941851-25941873 TTTTGTCTTAAGTGGGTGGAGGG - Intergenic
1115800184 14:36984751-36984773 TCTTGGGGTCTGTGGGTGAAGGG - Intronic
1115875319 14:37854581-37854603 TGAATGCTTTAGTGGGTGAAGGG + Intronic
1116602157 14:46939748-46939770 TCTTCACTTTAGTCTGTGAAAGG - Intronic
1117353924 14:54905653-54905675 TCCTGCCTTTAGTGAGTGGAAGG - Intergenic
1119501674 14:75133749-75133771 TATGTCCTTTAGTGGGTGAATGG + Exonic
1119782425 14:77285628-77285650 TCTTGGCTTTTATGGCAGAATGG - Exonic
1120952700 14:90057122-90057144 GCAGGGCTTTATTGGGTGAAAGG - Intergenic
1121678995 14:95777048-95777070 CCTTGGCTTTAATTGGTGGATGG + Intergenic
1124689191 15:31807604-31807626 TCGTGGATTTGGTGGGTTAAGGG + Intronic
1125043373 15:35217815-35217837 TCTTGGTGTCAGTGGGGGAATGG + Intronic
1128030868 15:64478922-64478944 TGTTTTCTTTAGTGGTTGAAAGG + Intronic
1129176122 15:73840949-73840971 TCTTGGCCGTGGTGGGGGAAGGG - Intergenic
1130710745 15:86278635-86278657 TTTTGGTTTTACTGGGGGAAAGG - Intronic
1130937325 15:88481561-88481583 TGTTGGCTTAATTTGGTGAATGG - Intergenic
1131022168 15:89108122-89108144 TCCTGTCCTTAGTGGCTGAAGGG - Intronic
1133341566 16:5039858-5039880 TCCTGGCTCTGGTGGGTGAGGGG + Intronic
1136187823 16:28598439-28598461 TCTTGGCACTGGTGGGTGTACGG - Intergenic
1136190295 16:28611433-28611455 TCTTGGCACTGGTGGGTGTACGG - Intronic
1137451679 16:48581007-48581029 TCTTGTCATTTGTGGGTGATTGG - Intronic
1137568456 16:49549202-49549224 TCTTGGCTTTGCCTGGTGAATGG + Intronic
1138495000 16:57402812-57402834 TTTTGGATTAAGTGAGTGAATGG - Intergenic
1141938507 16:87258398-87258420 TGTGGTCTTTAGTGGGTGAGTGG - Intronic
1143048334 17:4100949-4100971 TCTTGGCTTTCTTGGGTGAGGGG + Intronic
1145037222 17:19549707-19549729 TCTTGGGGTCCGTGGGTGAAAGG + Intronic
1147312532 17:39604047-39604069 TCTTGGCTTTAGCTGGTGGGTGG - Intronic
1147493359 17:40892773-40892795 TCTTGGGTATAGTGTGTGCATGG + Intergenic
1151517971 17:74608855-74608877 GTTTGGGTTCAGTGGGTGAATGG + Intergenic
1156844223 18:41645338-41645360 TCCTGCCTTTAGTGGCTGAGGGG + Intergenic
1160665803 19:327639-327661 TTCTGGCTTTGGTGGGTGGAGGG - Intronic
1161805659 19:6441732-6441754 TCTGGGATCTAGTGGCTGAAGGG + Exonic
1161831614 19:6609205-6609227 GCTTAACTTTAGTGGGTGCAGGG + Intergenic
1164846042 19:31433302-31433324 TTTTGGCTGGAGTGGATGAAGGG + Intergenic
1165102037 19:33444684-33444706 GCTTGGCTTTGGGGGGTGAGTGG - Intronic
924991374 2:315682-315704 GCTTGGCTGCAGTGAGTGAAAGG + Intergenic
925821364 2:7802722-7802744 TCTTGGATCTATTGGGAGAATGG + Intergenic
931165295 2:59740802-59740824 TCTTTGCATCAGTGTGTGAATGG - Intergenic
932498855 2:72162567-72162589 TCTTTGCTTTAGTGTATCAAGGG - Intergenic
935599997 2:104913041-104913063 AGTGGGCTTTACTGGGTGAATGG + Intergenic
937561916 2:123236371-123236393 TCATGTCTGTAATGGGTGAAGGG + Intergenic
939318796 2:140588330-140588352 GCTTCGCTTTACTGGGTAAATGG + Intronic
940026530 2:149214370-149214392 TATTGGCATTGGTGGGGGAAGGG + Intronic
942569166 2:177295875-177295897 CCTGGGTTTTAGTGGGGGAAGGG - Intronic
944206334 2:197162419-197162441 TCTTGGCTTTGGTGGGAAGAAGG - Intronic
944645378 2:201774657-201774679 TTTTGGCTTAATTCGGTGAAAGG + Intronic
945205135 2:207323462-207323484 CCTTGGCTTCAGTGCTTGAAGGG + Intergenic
946861351 2:224002818-224002840 TATTGGCTTAATTGGATGAAGGG - Intronic
947165070 2:227253549-227253571 TTTTGTCTTTAGGGTGTGAAAGG + Exonic
1175478634 20:59295604-59295626 TCTTGGCTGATGTAGGTGAAAGG + Intergenic
1175584719 20:60129357-60129379 TCTGTCTTTTAGTGGGTGAATGG + Intergenic
1175724749 20:61310206-61310228 TCTTTGCTAGAGTGGGTGATGGG + Intronic
1177244904 21:18510559-18510581 TCTTTGCTTCAGAGGGTGCAAGG + Intergenic
1177546367 21:22563225-22563247 TCATGGCTTTAGTGGTAGCAAGG - Intergenic
1178211294 21:30535875-30535897 TCTTGGCTTCAGAGGGGGTATGG + Intergenic
1178692408 21:34760784-34760806 CCTTGGATTTAGGGGATGAATGG + Intergenic
1179831013 21:43995907-43995929 TCTTGACTTTGATGGGTGGAAGG + Intergenic
1180990664 22:19933838-19933860 GCCTGGCTAAAGTGGGTGAAAGG - Intronic
1203294966 22_KI270736v1_random:33096-33118 TATTGGCTTTTTTGGGTGATTGG + Intergenic
957315138 3:78567048-78567070 TCTTAGCTGTAGTGGGTGCTGGG - Intergenic
958686453 3:97403858-97403880 GGTTGCCCTTAGTGGGTGAAAGG - Intronic
959831704 3:110870382-110870404 TCTTGTTTTTGGTGGGAGAAGGG - Intergenic
964907886 3:161740765-161740787 TTTTGGCTTTGGATGGTGAAAGG - Intergenic
969227995 4:5811679-5811701 TCCTGGCTGTGGTGTGTGAAGGG - Exonic
970435428 4:16029652-16029674 TCTTTTCTTTAGGGGGTGAAGGG - Intronic
973050346 4:45587961-45587983 CCTTGGCTTTATTGGGTGGTAGG - Intergenic
975895111 4:79079540-79079562 TCTTGCCTTGGGTTGGTGAAAGG + Intergenic
976385517 4:84453405-84453427 TCTTTGGTTTAGGGGTTGAAGGG + Intergenic
976771129 4:88653626-88653648 CTTTGGCTGTAGTGGGTCAAGGG + Intronic
978402163 4:108342469-108342491 TCTTGGCTTCAATGGGTGGCAGG - Intergenic
978503424 4:109433427-109433449 ACTGGGCCTCAGTGGGTGAAGGG - Intergenic
981211467 4:142111277-142111299 TCTTGGCTGTAGGGGCTGACTGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
986125396 5:4879133-4879155 TCTTGGCTTTGGGTGGTGACCGG + Intergenic
987442245 5:17969814-17969836 TGTTGGCTTCAGTGGCAGAAAGG - Intergenic
988726453 5:33931151-33931173 TCTTGGCTTCCATGTGTGAAAGG + Intergenic
989606044 5:43245610-43245632 TCTCGGCTTTAGTGAGAGGAAGG - Exonic
990009211 5:50975708-50975730 TCTTGTCTTTACTGGCTGTAAGG + Intergenic
991636972 5:68716066-68716088 TTTTGGCTTGATTGGATGAATGG + Intergenic
991650151 5:68844444-68844466 TCGTGTTTTTAGTTGGTGAAAGG + Intergenic
992731993 5:79680963-79680985 TCTTCACTTTTGTGGGTGAAAGG + Intronic
994014688 5:94951786-94951808 TCTTCCCTTTCGTGGGAGAAGGG + Intronic
994738961 5:103594602-103594624 TCTTGTCTTTTGTGGGGGACAGG - Intergenic
994999330 5:107107013-107107035 TTATGTCTTTAGTGAGTGAAGGG - Intergenic
997083777 5:130772093-130772115 TCTTGTTTTTAGGGGGAGAAGGG + Intergenic
997372332 5:133370003-133370025 TCTTGGCTTGGGTGGGTGGAGGG - Intronic
997695609 5:135858449-135858471 TCTTGGCAGTAGTGGCTGAGTGG + Intronic
997999952 5:138617143-138617165 TCTTGGCATTAGTGGCTTCAAGG + Intronic
1001786324 5:174416966-174416988 TCATGGCTTGGGTGGGGGAAAGG - Intergenic
1003279503 6:4679263-4679285 TCTTGGGTTTACTGGGGAAAGGG + Intergenic
1003484776 6:6566008-6566030 TCTTGGTGTTATTGAGTGAATGG + Intergenic
1005097972 6:22139311-22139333 TTTTGTCTTAAGTGAGTGAATGG - Intergenic
1005101105 6:22173352-22173374 TCTTTGCTTCAGAGGGTGCAAGG + Intergenic
1008041768 6:46809085-46809107 TCTCTGCTTCAGTGGGGGAAAGG + Intronic
1009028212 6:58025242-58025264 TCTTGCATTTAGTGAGTGCATGG + Intergenic
1009203747 6:60776627-60776649 TCTTGCATTTAGTGCGTGCATGG + Intergenic
1012321497 6:97852895-97852917 TCTTGGCTTTTTTGGTTAAAAGG + Intergenic
1013394021 6:109716028-109716050 TCTTGGCTTTATTTGGAGATCGG + Intronic
1014974629 6:127863967-127863989 TCTTGGCTTTAATGGTAGAAGGG - Intronic
1016634802 6:146275631-146275653 TCTTGGCTTTGGAGGCTGATTGG - Intronic
1017424033 6:154302477-154302499 TCTTCTCTTTAGTGGGGGAAGGG + Intronic
1017530053 6:155280782-155280804 TCTTGAGTTTGGTGGGTGGATGG - Intronic
1022932805 7:35138648-35138670 TCTTGCCTTTATTGGGGAAATGG - Intergenic
1023916098 7:44590481-44590503 TCTTGACTTTAGTTTTTGAAGGG - Intergenic
1023976762 7:45036283-45036305 TGTCTGTTTTAGTGGGTGAATGG + Intronic
1031820073 7:126489917-126489939 TCTTGGCTCTGGTGGGGGAGGGG - Intronic
1033036115 7:137877945-137877967 TCCTTGCTTGAGTGGGTTAAAGG - Exonic
1034178505 7:149119416-149119438 TTTTGGGTAAAGTGGGTGAAGGG - Intronic
1036212299 8:6852320-6852342 TCTTGGCTGTAGGGAGAGAAAGG + Intergenic
1036603173 8:10282155-10282177 TGTTGGCTTTTGTGGATGAAAGG - Intronic
1036947119 8:13105057-13105079 TTTGGGCTTTAATGGTTGAATGG + Intronic
1037488382 8:19372465-19372487 CCTTGGCTTTAGTGGTGGGAGGG + Intronic
1041255656 8:55978032-55978054 TCTTGGCTTTAGTGAGGGGTTGG - Intronic
1042938613 8:74085482-74085504 TCTTTGGTTTCGTGGGTGATTGG - Intergenic
1044031064 8:87238209-87238231 TCTTGGCCAGAGTGGGGGAAAGG + Intronic
1044948306 8:97412040-97412062 TTTTGGGTTTAGTGACTGAATGG - Intergenic
1045483285 8:102610143-102610165 TCTTGGCTTTTGTTGGTGTGTGG + Intergenic
1047705256 8:127492813-127492835 TTTTGGCTTTTGAAGGTGAAAGG - Intergenic
1049336379 8:142088888-142088910 TCGTGGCTGCAGTGAGTGAATGG - Intergenic
1051014650 9:12460356-12460378 TCAGGGTTTTATTGGGTGAAAGG + Intergenic
1051483229 9:17580915-17580937 TCTTGGCTTTGGAGTGGGAAAGG + Intronic
1051655749 9:19380077-19380099 TCCTGGCTTTAGGTGGAGAAGGG - Intronic
1051724261 9:20072338-20072360 TCTTGCCTTGAGTGGGTGAAAGG + Intergenic
1052482015 9:29042442-29042464 TCTGTCCTTCAGTGGGTGAATGG + Intergenic
1054855150 9:69891412-69891434 TGTTTGCTTTAGTGGAGGAAGGG - Intronic
1055394996 9:75864599-75864621 TCTTTGCTTTATTGAGTGACTGG + Intergenic
1056656573 9:88514498-88514520 TTTTGGTTTTAGTGGGTGTCAGG - Intergenic
1057829184 9:98394063-98394085 CCTTGGCTTCAGGGGGTCAAGGG - Intronic
1186041882 X:5488373-5488395 TCTTGGCTGTAGTGGCTAGATGG + Intergenic
1186429398 X:9491699-9491721 TCTAGGCTTTTGGGGCTGAATGG + Intronic
1188284347 X:28310166-28310188 TCTTGGTTTTAGTGGGTTTGGGG - Intergenic
1190245244 X:48686651-48686673 TCATGGAGGTAGTGGGTGAAGGG - Intronic
1192276959 X:69642192-69642214 TTTTAGCTTTAGAGGCTGAAAGG + Intronic
1193913418 X:87334193-87334215 TGTTGCCATTAGTGGATGAATGG - Intergenic