ID: 1085508443

View in Genome Browser
Species Human (GRCh38)
Location 11:77073301-77073323
Sequence CTGCAGGCCTTGGGCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 420}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085508443_1085508448 -8 Left 1085508443 11:77073301-77073323 CCTGTCCTGCCCAAGGCCTGCAG 0: 1
1: 1
2: 2
3: 38
4: 420
Right 1085508448 11:77073316-77073338 GCCTGCAGGAACCCCTGACCTGG 0: 1
1: 0
2: 0
3: 25
4: 220
1085508443_1085508456 22 Left 1085508443 11:77073301-77073323 CCTGTCCTGCCCAAGGCCTGCAG 0: 1
1: 1
2: 2
3: 38
4: 420
Right 1085508456 11:77073346-77073368 TTTCAGAAGCTCCTCTCCCTTGG 0: 1
1: 0
2: 3
3: 29
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085508443 Original CRISPR CTGCAGGCCTTGGGCAGGAC AGG (reversed) Intronic
900122516 1:1054850-1054872 CCGTAGGCCTTGGGCAGTGCTGG - Exonic
900184928 1:1328530-1328552 CTGGGGGCCTTGGGCTGGGCTGG - Exonic
900203662 1:1421988-1422010 CTGGGGGCCTGGGGCAGGATGGG + Intergenic
900243710 1:1628413-1628435 CCCCGGTCCTTGGGCAGGACTGG - Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900369305 1:2324279-2324301 CTCGGGGCCATGGGCAGGACGGG + Intronic
900411044 1:2512821-2512843 CCGCAAGCCTGGGGCAGGACAGG + Intronic
900432195 1:2607683-2607705 CTGCAGGCCTTTGACCTGACGGG - Intronic
900714146 1:4133267-4133289 GGGCAGGCCTGGGGCAGGCCTGG + Intergenic
901647715 1:10725658-10725680 CTCCAGGCCTGGGGGAGGCCAGG + Intronic
901868905 1:12126068-12126090 CTTGGGGCCTTGGGGAGGACAGG + Intronic
902553032 1:17230482-17230504 CACCAGGCCTGGGGCAGGGCAGG - Intronic
902816710 1:18920657-18920679 CTGAAGGCCTTGGAGAGGGCAGG - Intronic
903156186 1:21445388-21445410 CTGCAGGCCATGGGCGGCACAGG - Intronic
904918306 1:33986080-33986102 CGGCAGGCATTGGGCTGGACTGG - Intronic
905276920 1:36824436-36824458 CTTCAGGCCTCTGGCAGCACAGG + Intronic
905651678 1:39661010-39661032 GTGCAGGCCAAGGGCAGGTCTGG + Intronic
905874800 1:41426048-41426070 CGGAGGGGCTTGGGCAGGACTGG + Intergenic
905874812 1:41426092-41426114 CGGAGGGGCTTGGGCAGGACTGG + Intergenic
905874836 1:41426180-41426202 CAGAGGGGCTTGGGCAGGACTGG + Intergenic
905874847 1:41426224-41426246 CGGAGGGGCTTGGGCAGGACTGG + Intergenic
907666069 1:56434851-56434873 CTGCAGGAGGTGGGCAGGTCTGG + Intergenic
908128761 1:61054097-61054119 CTGCAGGCCCTGAGAGGGACTGG - Intronic
908444487 1:64188368-64188390 CTGAAGCGCCTGGGCAGGACTGG - Intergenic
912906623 1:113714501-113714523 CTGCAGGCCTGGGGCAGCGGTGG + Intronic
913375192 1:118143899-118143921 CTGCAGGCAGTGGGCAAGGCAGG - Intronic
914416853 1:147492160-147492182 CTGCAGAACCTGGGCAGGCCAGG - Intergenic
914987175 1:152471139-152471161 CTGTAGGGCATGTGCAGGACTGG - Intergenic
917468796 1:175308166-175308188 CTGAGGGCCTGGGGCAGCACAGG + Intergenic
917979006 1:180257981-180258003 CTTCAAGCATTGCGCAGGACTGG + Intronic
918295078 1:183148983-183149005 CTGAAGGACTTAGGAAGGACTGG + Intergenic
918550338 1:185734582-185734604 CTCCAGGGGTTGGGCAGGGCAGG - Exonic
919785038 1:201253515-201253537 CTGCATGCCATGTGCAGCACCGG + Intergenic
920057413 1:203202605-203202627 CTGGAGGCCTGGGGTAGGAATGG - Intergenic
922502037 1:226104428-226104450 CTCCAGGGCCTGGGCAGCACTGG - Intergenic
922585962 1:226735774-226735796 CTGCAGGCCTTCCTCAGGAAAGG + Exonic
922797714 1:228349199-228349221 CTGCAGGCCCTAGGCTGGGCAGG + Intronic
922891166 1:229062783-229062805 CTGCAGCCCATGGGAAGCACAGG - Intergenic
923591856 1:235327385-235327407 CTGTGGGCCGCGGGCAGGACCGG + Intronic
923855187 1:237838641-237838663 CTGGAGGCCTGTGGCAAGACTGG - Intergenic
924386730 1:243506167-243506189 CTGCGGTCCTTGGGCCTGACGGG - Intronic
1063097517 10:2921461-2921483 CTGCAGGGAATGGGCAGGGCTGG + Intergenic
1063127338 10:3147364-3147386 GTGCACGGCTTGGGCAGGGCTGG + Intronic
1066513940 10:36134208-36134230 CTGCAGGGGGTGGGCAGGGCAGG - Intergenic
1067269323 10:44775688-44775710 CTGCAGGTATGGGCCAGGACAGG - Intergenic
1067528428 10:47052452-47052474 GTGAAGGCCATGGGGAGGACAGG - Intergenic
1067749219 10:48958936-48958958 TTGCAGGCCCTGGGGAGGTCAGG + Intronic
1068763156 10:60734102-60734124 CCGCCGGCCTTGTCCAGGACAGG - Intergenic
1069659514 10:70114397-70114419 CTGAAGGCCTCGGGAAGGATCGG - Intronic
1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG + Intergenic
1071574550 10:86716020-86716042 ATGCAGGCCTTGGGCAGTCAAGG + Intronic
1073123472 10:101135541-101135563 CTGCTGGCCTAGGGGAGGAGAGG + Intronic
1073196155 10:101694188-101694210 ATGGAGGCCTTGGGGAGGAGGGG + Intronic
1073458866 10:103654041-103654063 CTGGAGGCATTGAGCAGGGCTGG - Intronic
1074416681 10:113273147-113273169 CTGAAGGCTTTTGGAAGGACTGG - Intergenic
1074872352 10:117587222-117587244 TGGAAGGCCTTAGGCAGGACAGG - Intergenic
1075736714 10:124668901-124668923 CATCAGGCCTTGGGAAGGAGTGG - Intronic
1076138844 10:128064017-128064039 CAGCAGGCCCTGAGCAGGGCCGG - Intronic
1076250761 10:128982342-128982364 CTGCAGGCCTTTCGCGGGCCAGG + Intergenic
1076737668 10:132466012-132466034 CAGGGGGCCTTGTGCAGGACAGG + Intergenic
1076850596 10:133090656-133090678 CTGGAGGCCGTGGCCAGGGCAGG + Intronic
1076875757 10:133214774-133214796 CTGTGGGGCTTGGGCTGGACTGG + Intronic
1077123456 11:921749-921771 CTCCAAGCCTTTGGCAGGAAGGG + Intergenic
1077169327 11:1159308-1159330 CTGCAGGTCCTGGGCTGGGCCGG + Intronic
1077178838 11:1203323-1203345 CTGGAGGGCTTGGGCTGGGCCGG + Intergenic
1077295404 11:1824060-1824082 CTGCAGGCGCTGGGCAGCCCTGG + Intergenic
1077366960 11:2165147-2165169 CTTCTGGCCTTGAGCAGGGCTGG - Intronic
1077377778 11:2213350-2213372 CTGCAGGCATGGGGGAGGGCTGG - Intergenic
1077433814 11:2528657-2528679 CAGCAGGACTCTGGCAGGACTGG + Intronic
1077435113 11:2535209-2535231 CTGCAGGCTTTGGGCGGGTAAGG + Intronic
1079081212 11:17414842-17414864 CTGCAGGGCTGGGGCAGGCTGGG - Intronic
1080233818 11:30046475-30046497 CAGAAGGCCTTTGGCAGGACTGG + Intergenic
1081583846 11:44370825-44370847 CTGCAGGCCTGTGGCATGATGGG - Intergenic
1081669399 11:44934758-44934780 CTGCCTCCCTGGGGCAGGACTGG + Exonic
1082768790 11:57189583-57189605 CAGCAGGGCTTGAGCAGGAGTGG - Exonic
1083296844 11:61719621-61719643 CTGAAGGCCTTGGGAAGGTGGGG - Intronic
1083629531 11:64088447-64088469 CTGTGGGCCTGGGGCAGGGCAGG + Intronic
1084194951 11:67519227-67519249 CTGCAGGCCTTGGGGCGGGTGGG + Intronic
1084562930 11:69914327-69914349 CAGGAGCCCTTGGGCAGCACTGG + Intergenic
1084649305 11:70479383-70479405 CTGGAGGCCTTGGGAAGGGGAGG + Intronic
1084667331 11:70583437-70583459 CTGTAGGCACAGGGCAGGACTGG - Intronic
1084954398 11:72683785-72683807 CTGCAGGCCAAAGGCAGAACTGG + Intergenic
1085053221 11:73390359-73390381 CAGCAGGTCTGGGACAGGACAGG + Intronic
1085217448 11:74844866-74844888 GTGAAGGCCTAGGCCAGGACAGG + Intronic
1085390414 11:76179271-76179293 CTGCAGGGCTTCGTCAGGAAGGG + Intergenic
1085451621 11:76637519-76637541 CTGGAGGCCTGGTGCAGGACAGG - Intergenic
1085508443 11:77073301-77073323 CTGCAGGCCTTGGGCAGGACAGG - Intronic
1085593773 11:77789944-77789966 CTGCAGGCCTTGGGAGTGGCTGG + Intronic
1085739376 11:79065747-79065769 CTTGAGGGCTTGGGCAGGCCTGG + Intronic
1086569664 11:88267086-88267108 CTGCAGGCCTGGGGCAGTGGTGG + Intergenic
1088754301 11:112872906-112872928 CTCCTGGCCTTGGGCACAACTGG + Intergenic
1090874495 11:130776676-130776698 GTGGAGGGCTTGGGCAGGTCTGG - Intergenic
1091043231 11:132301701-132301723 CTGCAGAGCTGGTGCAGGACTGG + Intronic
1091165564 11:133472897-133472919 CTGGAGGGCTGGGACAGGACTGG - Intronic
1091347446 11:134864705-134864727 CAGCAGGCCGTGGGCACGGCAGG - Intergenic
1091363027 11:134993268-134993290 CTGGAGGCTTTGGGGAGCACCGG - Intergenic
1091841380 12:3623741-3623763 CTGCAGGCCTTCTGCAGAAGAGG - Intronic
1091896553 12:4109819-4109841 CCACAGGCCTTGGGAAGGCCAGG + Intergenic
1092441623 12:8509556-8509578 GTGCAGGCCTGGTGGAGGACAGG + Intronic
1092673199 12:10886335-10886357 CTGCAGGCCTGGTGCAAGACAGG + Intronic
1096405823 12:51343614-51343636 CTGCAGGCCCTGAACAGGAAAGG + Intronic
1096500527 12:52061775-52061797 CTCCAGCCCTTGGGCGGGGCAGG - Intergenic
1096513616 12:52144985-52145007 CAGCAGGCCTCGGCCAGGCCGGG - Intergenic
1096538830 12:52291781-52291803 CTGCAGGCATTGGGGAGGGAAGG + Intronic
1096575830 12:52552328-52552350 CTGCAGGCCGTGTGCAGAAAAGG - Intronic
1096599482 12:52719130-52719152 ATGCAGGCCTTGGGCTAAACTGG - Intergenic
1096673623 12:53214785-53214807 CTGCAGGCCCTGGGTGGGGCTGG - Intronic
1098849416 12:75577631-75577653 CTGCAGGCCTTGGGAAGCTTAGG - Intergenic
1099452697 12:82826816-82826838 CTCCAGGCATTGGGCTGGAAAGG - Intronic
1100792552 12:98146608-98146630 CTGCAGGCCTATGGTAGAACGGG + Intergenic
1101583868 12:106067472-106067494 GAGCAGGACTTGTGCAGGACTGG - Exonic
1102256502 12:111418482-111418504 CTGCGGGCCTTGGGCAGGCCAGG - Exonic
1102390825 12:112547285-112547307 ATGCAGTCCTTGGGCAGGATGGG + Intergenic
1102517818 12:113462322-113462344 CTCCAGGCCCTGGGCAGGGAGGG + Exonic
1103839450 12:123850695-123850717 CTGAAGGCCTTGGGGAGGGCAGG - Intronic
1104635438 12:130435569-130435591 GGGGAGGCCGTGGGCAGGACGGG - Intronic
1104707954 12:130961976-130961998 CTGCAGTCGTAGGGCAGGAGAGG - Intronic
1104733639 12:131122719-131122741 CCGCAGGGCCTGGGCAGAACAGG + Intronic
1104768931 12:131348280-131348302 CAGGAGGCCGTGGGCAGGGCTGG + Intergenic
1104810822 12:131619368-131619390 CAGGAGGCCGTGGGCAGGGCTGG - Intergenic
1104844196 12:131838665-131838687 CTGCGAGCCTGGGTCAGGACAGG - Exonic
1106585500 13:31053323-31053345 CTGTGGGCCTTGGCCAGGAATGG + Intergenic
1106910571 13:34458849-34458871 AGCCAGGCCTTGGGAAGGACTGG - Intergenic
1107000025 13:35532770-35532792 CTTCAGGCCTTGGGGATGATGGG + Intronic
1108521709 13:51252118-51252140 CTGCAAGGGTTGGGCAGGAGAGG - Exonic
1108599699 13:51981894-51981916 TTGCAGGCCATGGGTTGGACAGG - Intronic
1110999950 13:82165625-82165647 CGGGTGGCCATGGGCAGGACAGG + Intergenic
1113485652 13:110650648-110650670 GTGCTGCCCCTGGGCAGGACAGG + Intronic
1114524479 14:23359491-23359513 CTTCCGGCCTGGGGCAGGAGAGG + Exonic
1117189684 14:53277816-53277838 CAGAAGGCCATTGGCAGGACTGG - Intergenic
1117996886 14:61486140-61486162 CTGCAGGTCTTGGCTATGACAGG - Intronic
1118315989 14:64726499-64726521 CTGCAGCCTTTGGGAAGGACAGG - Intronic
1118718173 14:68575102-68575124 CTGCATGCCTTTTGCAGGCCAGG + Intronic
1118747832 14:68786595-68786617 CAGCAGACATTGGGCAGGCCAGG - Intergenic
1118988753 14:70779169-70779191 GTGAAGGGCTGGGGCAGGACTGG + Intronic
1119632656 14:76247175-76247197 CTGCAGGTCTTGGGATGGATGGG + Intronic
1121447306 14:93987329-93987351 CGGCAGCCCTTGGGTTGGACAGG - Intergenic
1121495372 14:94388472-94388494 CAGCAGGTCTGGGGCAGGAGGGG - Intronic
1122084062 14:99287302-99287324 GCTCAGGCCTGGGGCAGGACGGG + Intergenic
1122143597 14:99676216-99676238 CTGCAGGCCTGGGGCCCCACTGG + Exonic
1122263566 14:100536446-100536468 CTGCAGGCCTGAGGTAGCACAGG + Intergenic
1122694039 14:103544286-103544308 CTGCAGGCCTGGCCCAGGCCAGG + Intergenic
1122982077 14:105196509-105196531 CTGCAGGGCGGGGGCAGGAGCGG - Intergenic
1122988320 14:105223625-105223647 CTGGTGGCCTGGGGCAGGAGGGG + Intronic
1125349963 15:38756161-38756183 CTCCGGGCCTTGGGAAGAACTGG - Intergenic
1125538915 15:40458744-40458766 CTGGGGGGCTTGGGCAGGTCAGG - Exonic
1125584886 15:40813163-40813185 CTGCAGGGCTGGGGCAGGCAGGG + Intronic
1125757171 15:42071736-42071758 CTGAAGGCCCTGGGCAGCCCTGG - Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126113785 15:45190611-45190633 CTGCAGGCTTCATGCAGGACAGG + Intronic
1127916439 15:63459193-63459215 CTGCTGGCCCTGGGCAGTAAGGG + Intergenic
1128217641 15:65945391-65945413 CTGCAGGCCTGAGGGAGGAGAGG + Intronic
1128517395 15:68351229-68351251 CAGCAGCCCTTGGGCGGGCCAGG + Intronic
1129170195 15:73802902-73802924 CTGCAGGCCTGGCACAGGAAGGG + Intergenic
1129462618 15:75707514-75707536 CAGCAGGCAGTGGGCAGGAGTGG + Intronic
1129708682 15:77809202-77809224 CTGCAGGCCTCGGGCTGGAGGGG - Intronic
1130257095 15:82330909-82330931 CCGCAGCCCATGGGCAGGAGGGG - Intergenic
1130597855 15:85259081-85259103 CCGCAGCCCATGGGCAGGAGGGG + Intergenic
1131158505 15:90089619-90089641 CTGCAGGACAGGGGCAGGCCTGG + Intronic
1131622464 15:94082224-94082246 ATGCAGGCTATGGGGAGGACAGG - Intergenic
1132694961 16:1197989-1198011 CTGGAGGCGGTGGGGAGGACCGG - Intronic
1133164387 16:3936236-3936258 CTGCCAGCCTGGGGCAGGAATGG - Intergenic
1133208593 16:4249506-4249528 CTGCAGGTCCTGGGCAGGGATGG - Intergenic
1133298432 16:4767025-4767047 CTGCCGGCCGTGGGCAGTTCGGG + Exonic
1133303146 16:4795328-4795350 CTGCTGGCCCTGGGGAGGGCGGG + Intronic
1134717760 16:16365411-16365433 CTGCAGGCCGTGGTCAGGGATGG + Intergenic
1134956992 16:18386748-18386770 CTGCAGGCCGTGGTCAGGGACGG - Intergenic
1136346406 16:29679032-29679054 CTGCAGGCCTGGCAGAGGACAGG + Exonic
1138093899 16:54197171-54197193 CTCCTGACCCTGGGCAGGACAGG + Intergenic
1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG + Intergenic
1138459734 16:57141135-57141157 CTGCAGAGCTGGGGCAGGACTGG + Intronic
1139054014 16:63158923-63158945 CTACAGGCACGGGGCAGGACTGG + Intergenic
1139891621 16:70256765-70256787 CTGCAGGCCTCTGGCAGGCAGGG - Intronic
1141226326 16:82119548-82119570 CTGCAGGCCTGGGGTAGTGCTGG + Intergenic
1141617654 16:85219448-85219470 CTGCTGGCCTGGGGCTGGCCTGG + Intergenic
1142032146 16:87843950-87843972 CCCCAGGCACTGGGCAGGACTGG + Intronic
1142204769 16:88777759-88777781 CTGCAGGCCTTGGGGGGTCCAGG + Intronic
1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG + Intronic
1142292423 16:89199216-89199238 GTGGAGGCCTCGGGGAGGACTGG + Intronic
1142670128 17:1484287-1484309 CTGCAGGCCCTGGGCAGTGACGG - Exonic
1144852953 17:18253284-18253306 CTGCAGGTGCTGGGCAGGGCTGG - Exonic
1145056755 17:19708082-19708104 CTGGTGGGCTTGGGCAGGAGCGG + Intronic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1147340443 17:39750539-39750561 CTGCAGCCCAAGGGCAGGAAGGG + Intergenic
1147615591 17:41825479-41825501 CTGCAGGCCGTGGTGAGGAGGGG - Intronic
1147912259 17:43862694-43862716 GTCCAGGCCTTGGTCAGGTCAGG + Exonic
1148047054 17:44750699-44750721 CTGGAGCCCTTGGGCAAGGCCGG - Exonic
1148697286 17:49568109-49568131 CTGAAGGGCCTGGGCAGGACTGG + Intergenic
1148702896 17:49601184-49601206 CAGCAGTTCTGGGGCAGGACAGG - Intronic
1148984443 17:51609522-51609544 ATGAAGGCCTTGGGAAGGAATGG - Intergenic
1149560405 17:57604409-57604431 GTGCGGGACCTGGGCAGGACTGG + Intronic
1149654571 17:58303405-58303427 CTGCAGGCCTGGGGCGGGGGTGG - Intronic
1150250654 17:63702515-63702537 CTGGTGGCCTTTGGCAGGAAAGG - Intergenic
1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1151407408 17:73898114-73898136 CTGCAGGCATCAGACAGGACAGG + Intergenic
1151428630 17:74047858-74047880 CTGGAGCCCTTTCGCAGGACAGG + Intergenic
1151473540 17:74332463-74332485 CTGCAGGCTTTGGGAGGGATGGG - Intronic
1151577273 17:74959077-74959099 CTGCAGGGATTGGGCTGGACAGG - Intronic
1151597316 17:75086513-75086535 CTGCAGGCCTTGGCCAGGCGCGG - Intergenic
1151745858 17:76011434-76011456 CTGCAGCCCCTGGGCAGCTCTGG - Intronic
1151868743 17:76822235-76822257 CTGGAGGCCTGGGTCAGGATGGG + Intergenic
1152359006 17:79821651-79821673 GAGCTGGCCTTGGGCAGGTCTGG + Intergenic
1153959762 18:10130818-10130840 CTGCAGGCCTAGAGTAGGAAGGG - Intergenic
1156449681 18:37259762-37259784 CTGCAGGCCAGGGGGAGGATGGG - Intronic
1156458496 18:37308008-37308030 CAGCAGGTCCTGGGCAGGGCAGG + Intronic
1156459640 18:37314562-37314584 CTGCAGGACTTGGGGAGGGTAGG + Intronic
1156700691 18:39820862-39820884 CTGCTGACCTTGGGCTGAACTGG + Intergenic
1156997545 18:43485692-43485714 CTGGAGCACCTGGGCAGGACTGG - Intergenic
1157097230 18:44696987-44697009 CTGCAGGACTTGGGCAGGGGCGG - Intronic
1157470257 18:47983083-47983105 CTCCAGGTCTGGAGCAGGACTGG + Intergenic
1158627624 18:59085182-59085204 TTGCTGGCCTTGGCTAGGACAGG + Intergenic
1160456828 18:79007460-79007482 CTGGGTGCCTTGGGCAGCACTGG - Intergenic
1160519024 18:79493985-79494007 CTCCGGGCCTGGGGCTGGACGGG - Intronic
1160534468 18:79584817-79584839 CTGCAGGCCTTGGGGAGGCTTGG + Intergenic
1160780131 19:873818-873840 CTGCAGGCCTTGGCGTGGGCAGG + Intronic
1160805219 19:989625-989647 CCGCAGTCCTGGGGCAGGGCAGG + Intronic
1160859730 19:1232627-1232649 CTGCAGGCCTTGGGTCAGGCAGG - Intronic
1161056642 19:2193986-2194008 CTGCAGCGCTTGGACAGGCCTGG - Intronic
1161118286 19:2511631-2511653 CCCCAGAACTTGGGCAGGACGGG + Exonic
1161565711 19:5000934-5000956 CTGCAGGGGGTGGGCAGGAATGG - Intronic
1161585445 19:5103035-5103057 CTGCAGGCCATCACCAGGACTGG - Intronic
1161664384 19:5565951-5565973 CTGCCGGCCTGGGGCAGCTCTGG - Intergenic
1162034944 19:7933635-7933657 CTGCAGGCAGGGGGCAGTACAGG + Intronic
1162475542 19:10897364-10897386 CTGCAGGGTGTGGGCAGGCCTGG + Intronic
1162480044 19:10922501-10922523 CTGCAGGCCTTGGGCCCGGAGGG + Exonic
1162724465 19:12681609-12681631 CTGGAGGCCTTCGGCACCACCGG - Exonic
1163012563 19:14434586-14434608 CGGCAGGCCATCAGCAGGACTGG - Intronic
1163145872 19:15379210-15379232 CCGCGGGCCTAGGGCAGGTCGGG + Intronic
1163201284 19:15771256-15771278 CTGCAGGCCAAGGGCAGAAAGGG + Intergenic
1163361639 19:16850679-16850701 CTGCAGGACGTGGGCAGAGCTGG - Intronic
1163727254 19:18929678-18929700 CTGGATGCCTCGGGCAGGACTGG - Intronic
1163747183 19:19055483-19055505 CTGCAGGGCCAGGGCAGGGCTGG + Intronic
1163911955 19:20203522-20203544 CTGCAGACCTTGGCCTGTACAGG + Intergenic
1164273836 19:23699565-23699587 CTCCATGCTTTTGGCAGGACAGG - Intergenic
1164669278 19:30063571-30063593 CTGATGGCCTTGGGCAGGTTGGG - Intergenic
1165829777 19:38724631-38724653 CTGCAGGCCCTGGGCTGGCCGGG - Intronic
1165958869 19:39518425-39518447 TTGCAGGCCACGGGAAGGACTGG + Intronic
1167292201 19:48630494-48630516 CTGCAGCCCGTGGGCAGCTCCGG - Exonic
1167611315 19:50509004-50509026 CTGGAGGCCATGGGCAGGCTGGG + Intronic
1167851551 19:52206118-52206140 CTGCCGGCCTAGGGCAGGGAGGG + Intronic
1168099048 19:54131293-54131315 CTCCAGGCCCTGGGCAGGTGAGG - Exonic
925276393 2:2651205-2651227 CTGCAGGCCATGGGAAGCCCGGG - Intergenic
925423421 2:3729643-3729665 CTGCAAGCATCAGGCAGGACAGG - Intronic
925891824 2:8440536-8440558 CTGAAGCCCTTGGGCAGGAAAGG - Intergenic
926008230 2:9389261-9389283 CTGAAGGCCATGGCCACGACTGG - Intronic
926046381 2:9712488-9712510 CTGATGGCGTTGGCCAGGACAGG + Intergenic
926620148 2:15040081-15040103 CTGAAGGCCTTGAGCAGGGTTGG - Intergenic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
929419505 2:41776402-41776424 GTTCAGGCCATGGGCAGGCCTGG + Intergenic
929549638 2:42881251-42881273 CTGCAGCCCATGGACAGGCCTGG + Intergenic
929556780 2:42930470-42930492 ATGCAGCCCCTGAGCAGGACTGG - Intergenic
929964742 2:46525692-46525714 AAGCAGGCTTTGGTCAGGACTGG + Intronic
930018734 2:46987984-46988006 CTGCAGGGCTAGGGGAGGACAGG + Intronic
931563213 2:63586790-63586812 CTGCAGTCCTATAGCAGGACAGG - Intronic
931828286 2:66024444-66024466 CTGCAGGTCCAGGGCAGGAGTGG - Intergenic
933727192 2:85433656-85433678 CTGAGGGCCTCGGGCAGGAGGGG - Intronic
934117747 2:88812412-88812434 CTCCACGATTTGGGCAGGACAGG + Intergenic
934562480 2:95320465-95320487 GTGGCGGCCTTGGGCAGGTCTGG - Intronic
935106864 2:100052790-100052812 CTGCAGGGGCAGGGCAGGACAGG + Intronic
936439787 2:112541886-112541908 CTGGAGGCCTGGGGGAGGCCTGG - Intergenic
937252764 2:120534734-120534756 CTACAGGCCTGGGGCTGGGCTGG + Intergenic
938694486 2:133823082-133823104 CTGCATGTCTTCGGCAGGAAGGG - Intergenic
941290438 2:163667464-163667486 ATGCAGGCCTTGGACAGAAGGGG - Intronic
943932242 2:193868695-193868717 CTGCAGCCCTTCGGGAGGCCAGG + Intergenic
948029189 2:234802421-234802443 CTGCAGCTCATGGGCAGCACTGG + Intergenic
948050516 2:234976245-234976267 TTGAAGGGCTTGGGCAGGACAGG + Intronic
948166897 2:235869953-235869975 CTTCAGGCTTTGGCCAGGAGTGG + Intronic
948461199 2:238130779-238130801 CTGCGGGGCTTAGGCAGGGCTGG - Exonic
948782034 2:240327763-240327785 CTGCTCGCCTTTGGCAGGCCTGG + Intergenic
948913131 2:241015756-241015778 CGGGAGGCCTTGGCCAGCACAGG - Intronic
1169141759 20:3230648-3230670 CTGCAGGCAGGGGGCAGGGCGGG + Intronic
1171198718 20:23224099-23224121 CTCCTGGCCATGGGCAGGTCTGG - Intergenic
1172113262 20:32559863-32559885 CGGCAGGGCCTGGGCAGGCCTGG - Intronic
1172126215 20:32626798-32626820 GAGCAGGCCTTGGGCAGAACTGG - Intergenic
1172181854 20:33008416-33008438 CTGTGGGCCTGGGGCAGGGCTGG + Intronic
1172569927 20:35962037-35962059 CTGCAGGCCTTAGGGAGAGCTGG - Intronic
1173255484 20:41391900-41391922 CTGCAGCCCTTGGGCAGATGTGG + Intergenic
1175056604 20:56204439-56204461 CTGCATCACTTGGGCACGACTGG + Intergenic
1175715699 20:61253053-61253075 CCCCAGGCCTTGGGCAGGAGAGG - Intronic
1175762789 20:61572622-61572644 CTGGGGGCCTTGTTCAGGACTGG - Intronic
1175773876 20:61641099-61641121 CTGCAGGCGCTGGGCAGGGTGGG + Intronic
1175808022 20:61841509-61841531 CTGGTGGCCTTGGGCAGTAGAGG + Intronic
1175890949 20:62315674-62315696 CTGTAGGCCTTGGGGGGGATTGG - Intronic
1175964881 20:62655474-62655496 CAGAAGGCCTTGGGCAGTAGGGG + Intronic
1176170896 20:63695976-63695998 CTGCAGGCCTCAGGCAGGCGGGG + Exonic
1178379931 21:32099311-32099333 AGCCAGGCCTTGGGCAGGGCAGG + Intergenic
1178911189 21:36674862-36674884 CAGAAGCCCTGGGGCAGGACTGG - Intergenic
1179062910 21:37996049-37996071 CTGCTGGACTTCAGCAGGACTGG + Intronic
1179595263 21:42438861-42438883 CTGCAGGAGGTGGGCAGGAATGG + Intronic
1179635108 21:42703717-42703739 CTGCTGGCCTTGGGCTGTGCGGG + Intronic
1179789357 21:43747582-43747604 CTGCAGGCTGGGCGCAGGACAGG - Intronic
1179890929 21:44334755-44334777 CAGCAAGGCTCGGGCAGGACAGG + Intronic
1179908775 21:44437272-44437294 CTGCAGCCCCTGGGCAGGGAGGG + Intronic
1179928529 21:44551702-44551724 CGGCTGGTCCTGGGCAGGACCGG + Intronic
1180148927 21:45937779-45937801 CAGCTGGCCTAGGGCAGGGCAGG + Intronic
1180156960 21:45982540-45982562 CTGCAGGCGCTGGGCTGGCCGGG + Intronic
1181009829 22:20033575-20033597 GAGCAGGCCTTGGGCAGCCCTGG + Intronic
1181407367 22:22694509-22694531 CTGGAGGCCTGGGGCTGGGCAGG - Intergenic
1181415365 22:22755276-22755298 CTGGAGGCCTGGGGCTGGGCAGG - Intronic
1181630861 22:24150606-24150628 GTGCAAGCCTAGGACAGGACAGG + Intronic
1181670980 22:24425291-24425313 CTGGAGGCCTTGGGTGGGGCTGG + Intronic
1181890268 22:26056683-26056705 CTGCAGGGGTCGGGCAAGACAGG - Intergenic
1181987592 22:26811368-26811390 CTGCAGGCCTGGGGTTGGTCAGG - Intergenic
1182107537 22:27699955-27699977 CTGCAGGTCTTGAGCAGGGGAGG - Intergenic
1182447010 22:30395755-30395777 CTTCTGGCCTGGGGCAGGACAGG - Intronic
1183118225 22:35708466-35708488 CAGGAGGTCTTGGACAGGACAGG - Intergenic
1183278949 22:36922143-36922165 GTGCTGGCCATGGGCATGACAGG - Exonic
1183739938 22:39663850-39663872 CTGTAGCCTTTGGGCAGGGCAGG + Intronic
1184158330 22:42683575-42683597 CTAGAGGCCCTGGGCTGGACGGG - Intergenic
1184357648 22:43993177-43993199 CTGCAGGCCCGGGGCTGGAGGGG + Intronic
1184448567 22:44569323-44569345 CTGCAGGGGATGGGGAGGACAGG + Intergenic
1184749048 22:46473697-46473719 GTGAAGGCCTCGGGAAGGACAGG - Intronic
1184765636 22:46570603-46570625 CTGCAGGGCTGTGGCAGGGCAGG - Intergenic
1184916892 22:47575435-47575457 CTGAAGGCCAAGGGAAGGACAGG - Intergenic
1185036396 22:48479386-48479408 CTGCAGGCTCAGGGCAGGTCGGG - Intergenic
1185291001 22:50027696-50027718 CCGCAGGCCTTTTGCAGCACAGG + Intronic
949261620 3:2108091-2108113 CTGCAAGCCTGGGGGAGGATAGG - Intronic
950145050 3:10642977-10642999 CAGCAGGACTGGGGCAGGCCAGG + Intronic
950508549 3:13411607-13411629 CTGCAGGCTGTGGCCAGGAAGGG + Intronic
950590801 3:13934790-13934812 TGGCAGGCCTTGGGCTGGAGAGG + Intergenic
950628711 3:14267238-14267260 CTGGAGGCCCTGGGCAGCCCTGG - Intergenic
950976051 3:17246843-17246865 GTACAGGCTTTGGGCAGCACAGG - Intronic
952793153 3:37216450-37216472 CTGCTGGCCTTGTCCAGAACTGG + Intergenic
954005520 3:47587465-47587487 CAGCAGGCCTAGGGAAGGAGCGG + Exonic
954622111 3:52002266-52002288 ATGGAGTCCTTGGGCATGACTGG + Intergenic
954637078 3:52076839-52076861 CTGGGGGCCTTTGGCAGGCCAGG - Intronic
954671331 3:52292794-52292816 CTGCAGGGCTCGGGCAGGGGTGG + Exonic
954711416 3:52506803-52506825 CTGCAGTGCTTGGGCAGGATGGG - Exonic
960874784 3:122285598-122285620 GTCAAGGCATTGGGCAGGACTGG - Exonic
961174343 3:124821515-124821537 CTGCATGACCAGGGCAGGACTGG - Intronic
961320288 3:126068322-126068344 ATGCCGGCCTGGGGCTGGACAGG - Intronic
961513734 3:127420157-127420179 CTGCAGCCCATGGGCAGGAGGGG + Intergenic
961524604 3:127488759-127488781 AGTCAGGCCTTGGGCAGGTCTGG - Intergenic
961666523 3:128496444-128496466 CTGCGGGCCGCGGGCAGGGCGGG + Intergenic
961674657 3:128557178-128557200 GTGCAGGCCTTGGTGGGGACAGG + Intergenic
962894966 3:139705815-139705837 CTTCAGGCCTTGGACAGAATTGG - Intergenic
964004701 3:151813106-151813128 CAGCAGGCCTTGGCCAGGGAGGG - Intergenic
964257579 3:154794600-154794622 GAGCAGCCCTTGGGCAGGGCAGG + Intergenic
965079525 3:164019593-164019615 CAGCAGGCCTTGGCCAGGGAGGG + Intergenic
968443957 4:639085-639107 CTACAGGTCCTGGGCAGGAAAGG + Intronic
968727907 4:2256764-2256786 TGGCAGCCCTTGGGGAGGACAGG - Intronic
969210106 4:5680905-5680927 CTGCAGGCTTTGGGAAGATCTGG + Intronic
969313337 4:6366962-6366984 CAGAAGGCTCTGGGCAGGACAGG + Intronic
969516590 4:7651642-7651664 CTGCTGGCAGTGGGCTGGACAGG + Intronic
972229207 4:37051202-37051224 CTGCAGGCTTTAGGCATTACAGG + Intergenic
972687094 4:41361573-41361595 CTGCAGTCCTTGGGATGGAGAGG - Intronic
973146280 4:46831060-46831082 CTGCAAGCCTTGTGCAGCCCGGG - Intronic
975762918 4:77635687-77635709 CAGAAGGCCTTTGGCAGGACTGG - Intergenic
975882682 4:78929182-78929204 TGGTGGGCCTTGGGCAGGACAGG + Intronic
975994939 4:80302948-80302970 CTGCAGGCCCTGGGCAGTGAGGG + Intronic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
976342836 4:83964308-83964330 CTGGAGTGCCTGGGCAGGACTGG + Intergenic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
978347640 4:107788507-107788529 CAGGTGGCCATGGGCAGGACAGG + Intergenic
979328608 4:119405110-119405132 GAGCAGGCCTTGGCCAGGCCTGG - Intergenic
980799752 4:137733844-137733866 CTGCAGGCCCTGGGCAATAAGGG + Intergenic
983667848 4:170202183-170202205 CTGGAGTCCTTGGGCAGGCTGGG - Intergenic
985315967 4:188659231-188659253 CTGCAGGCGCTGGGCAGGCGCGG + Intergenic
985510600 5:311206-311228 CTGTGGGCCTTGGGCAGGAGGGG + Intronic
985519922 5:369372-369394 CTTCAGGCTGTGGGCAGGAGGGG - Intronic
985660686 5:1155461-1155483 CTGCAGGCCCCGGACAGGGCGGG + Intergenic
985732379 5:1556526-1556548 CTGCTGGCCCTGGGGAGGCCAGG - Intergenic
986481128 5:8189398-8189420 CTGCAGAGCTTGCGCAGTACTGG - Intergenic
986785922 5:11113775-11113797 CTGCAGTCCTGGGGTGGGACTGG + Intronic
991031347 5:62085381-62085403 CTGCTGGGCTGGGGCAGGCCAGG - Intergenic
991291130 5:65034984-65035006 CGGCAGCCCTGGGGCAGAACAGG - Intergenic
996311681 5:122113178-122113200 CTTAAGGCCTTGGGCAGGGAGGG + Intergenic
997158205 5:131580285-131580307 CTGCCGGCCCTGGGCAGTAAGGG - Intronic
998401281 5:141850311-141850333 CTGGAGGCCTTGGAGAGGGCTGG - Intergenic
999181755 5:149674773-149674795 CTCCAGGCCTGGGGCTGGCCAGG - Intergenic
999450684 5:151675629-151675651 TTAAAGGCCTTGGGGAGGACTGG - Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1002297554 5:178239962-178239984 TTTCAGGCCTTGGGCAGGAATGG + Intronic
1002310170 5:178309339-178309361 CTGCAGGCCTGGAGCTGGGCAGG + Intronic
1002780020 6:358622-358644 CGGCAGGCCCTGGGCAAGGCAGG + Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004619527 6:17320842-17320864 CAGCAGGCCTTGGCCAGGGAGGG + Intergenic
1006453621 6:34119881-34119903 CCGCAGGCCTGGGGTAGGAAGGG - Intronic
1008667405 6:53729617-53729639 CTGCAGGCCGGGGACTGGACAGG + Intergenic
1011208520 6:84928526-84928548 CTGAAGGTCTTGGGATGGACAGG - Intergenic
1011957810 6:93045037-93045059 CTTCAGGCTTTGGGCGGGAGCGG + Intergenic
1017326916 6:153150823-153150845 CTGGAACTCTTGGGCAGGACCGG - Intergenic
1017880895 6:158561592-158561614 GTGAGGGCCTTGGCCAGGACAGG + Intronic
1018601915 6:165553028-165553050 ATGTAGGCTTTGGGCAGGAATGG - Intronic
1018936077 6:168274780-168274802 CTGCAGGCCTCAGGCTGGAGAGG - Intergenic
1018949287 6:168368745-168368767 CTGAAGGCCTTTGTGAGGACAGG + Intergenic
1019550207 7:1598464-1598486 CTGCTGGCCTTCTGCAGGACTGG + Intergenic
1019601680 7:1886847-1886869 CTGCTGGCCTGGGCCAGGAAGGG - Intronic
1019760870 7:2811692-2811714 CAGCAGCCCTTGGGCAGCATTGG - Intronic
1020543593 7:9493730-9493752 CTGCTGGTCATGGGCAGAACAGG - Intergenic
1020747008 7:12091088-12091110 CTGGAATGCTTGGGCAGGACTGG - Intergenic
1022479004 7:30730920-30730942 CTCAAGGCTTTGGGCAGGAGAGG - Intronic
1023883673 7:44335646-44335668 CTGCAGGAATTGGGTAGGTCCGG + Intergenic
1024055456 7:45657519-45657541 CTGAGGGCCTTAGGCAGGAGGGG - Intronic
1025204588 7:56984982-56985004 CTGCAGGCCGAGGGCAGGCCCGG - Intergenic
1025667349 7:63591953-63591975 CTGCAGGCCGAGGGCAGGCCCGG + Intergenic
1026502227 7:70952545-70952567 CTGCTGGCCTCAGGCAGGAAAGG + Intergenic
1027421145 7:78019463-78019485 CTGGAGGCCGAGGGCAGGGCGGG - Exonic
1028270448 7:88781925-88781947 CTCCAGGCCTTGGCCAAGATGGG + Intronic
1032011481 7:128350789-128350811 GTGCAGGTCTCGGGCAGGGCAGG + Exonic
1032530772 7:132617859-132617881 CTGCAGGTCTTGGGCTGGTAGGG + Intronic
1032622790 7:133554629-133554651 CAGCAGGCCTAGGAAAGGACAGG - Intronic
1033212676 7:139471763-139471785 CTGCAGGCAGCTGGCAGGACAGG + Intronic
1034412592 7:150949050-150949072 CTGGAGGCCATGGAGAGGACAGG + Intronic
1034460253 7:151194110-151194132 CAGCAGGGCCTGGGCAGGGCAGG + Intronic
1034559408 7:151870623-151870645 CTCCAGCCCCGGGGCAGGACGGG + Intronic
1034622333 7:152464990-152465012 CTGCAGGCGTTGGACAGATCCGG - Intergenic
1034672542 7:152869417-152869439 CTGCTGGCCCTCAGCAGGACTGG - Intergenic
1035262681 7:157671769-157671791 CTTCAGGCCTTGTGCAGTTCAGG - Intronic
1035405666 7:158595530-158595552 CTGCAGGCCTGAGGCAGCTCTGG - Intergenic
1036756997 8:11477349-11477371 GGGCAGGCCTTAGGCAGGAAGGG + Intergenic
1037503227 8:19505505-19505527 CTGCTGGCCTGGGTCTGGACAGG - Exonic
1037786078 8:21904060-21904082 CTGGAGACCTCAGGCAGGACAGG - Intergenic
1037900217 8:22683872-22683894 CTGCAGGCCCTGGGCAGGCCTGG + Intergenic
1039953116 8:42187649-42187671 CATCAGGCCTGGGGGAGGACGGG - Intronic
1040302222 8:46194024-46194046 CTGCCGGCCTGGGGCAGCACTGG - Intergenic
1040436749 8:47398657-47398679 CTGCAGTCCACGGGCAGGCCTGG + Intronic
1041730075 8:61053932-61053954 CAGCAGGCCTTGGGCAGGACTGG - Intergenic
1043960853 8:86416941-86416963 GAGCAGGCCTTGGGCAGCAAGGG - Intronic
1046562403 8:115854542-115854564 CTCAAGGGGTTGGGCAGGACTGG - Intergenic
1047480347 8:125276184-125276206 ATGCTGGCCCTGGGCAGTACAGG - Intronic
1049098629 8:140563694-140563716 CAGCAGGCCCTGGGCAGGCTAGG - Intronic
1049254017 8:141604534-141604556 CTGAGGGCCTTGGACAGGAGAGG - Intergenic
1049358019 8:142198330-142198352 CTGCTGGGCTGGGGCAGGAAGGG + Intergenic
1049621179 8:143598980-143599002 CAGCTGGGCTTGGGCAGGGCGGG - Exonic
1049767243 8:144360584-144360606 CTGCAGGTCCTTGGCAGGGCTGG + Exonic
1049799992 8:144513264-144513286 GTGCAGGCCGTGGGCCGGGCCGG - Exonic
1050959705 9:11713006-11713028 CCTGAGGTCTTGGGCAGGACTGG + Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1051531089 9:18104478-18104500 CTGCAGGTTATGGGCAGCACTGG - Intergenic
1051809665 9:21034311-21034333 TGGCAGGACGTGGGCAGGACTGG - Intergenic
1052158584 9:25226530-25226552 CTGCAGGTCCTGGGCTGGCCTGG + Intergenic
1057230306 9:93317714-93317736 CTGGGGGCCCTGGGCAGGCCAGG + Intronic
1058102255 9:100929894-100929916 CAGTAGGCCTGGGGCAGGGCTGG + Intergenic
1058668661 9:107342474-107342496 CTGCAGCCCCTGGGCAGGGGAGG + Intergenic
1059415941 9:114162591-114162613 CTGCCTCCCGTGGGCAGGACTGG + Intronic
1059430848 9:114249467-114249489 TTGGAGGCCTTGGGCTGGAGGGG + Intronic
1060115425 9:120936481-120936503 CTGAAGGCTTTGGGCAAGGCTGG - Intergenic
1060297780 9:122355002-122355024 CTGCAGACCTCTGGCTGGACTGG - Intergenic
1060719396 9:125965187-125965209 CTGCAGGTCTGAGGCAGGAAGGG + Intronic
1061507325 9:131038848-131038870 TTGCAGGCTATGGGCAGGAGTGG - Exonic
1061630481 9:131869196-131869218 GTGGAGGACTTGGGGAGGACAGG - Intronic
1062033348 9:134371952-134371974 CTGCCAGCCTGGTGCAGGACTGG + Intronic
1062036491 9:134384860-134384882 CTGCAGGCGGTGCTCAGGACTGG - Intronic
1062218785 9:135403381-135403403 CTGCAGGCCTGGGGCTGAGCCGG - Intergenic
1062243435 9:135551636-135551658 GTGAGGGCCTTGGGCAGGGCAGG + Intergenic
1062334148 9:136057649-136057671 CTGCAGCCCTGGGGGAGGAGGGG - Intronic
1062568202 9:137172575-137172597 CTCCAGGGCTGGGGCAGGAAGGG + Intergenic
1188833440 X:34928660-34928682 CTCCAGGCCTTTGACAGGAGAGG + Intergenic
1189374965 X:40459655-40459677 AGGCAGGCTTTGGGCAGGGCTGG - Intergenic
1190619362 X:52269834-52269856 TAGCAGGCTTTGGGCAGGTCAGG + Intergenic
1192151455 X:68715216-68715238 CAGCAGCCCTTGGGCTGGAAGGG - Intronic
1192168206 X:68839098-68839120 CTCCAGGGGTTGGGCAGGAGAGG + Intronic
1194387821 X:93278517-93278539 CTGTGGGCCTGGGGCAGTACTGG + Intergenic
1194448140 X:94011473-94011495 CTGTAGTTGTTGGGCAGGACTGG + Intergenic
1195068402 X:101257710-101257732 CTGCAGGCCCTGGGAAACACTGG + Intronic
1198322445 X:135531901-135531923 CTGAAGGCCTGGGGGAGGAGAGG + Intronic
1199995977 X:153027078-153027100 CTGCAGGCCTTGGTCAAGAGAGG - Intergenic
1200035067 X:153321438-153321460 CTGCGGGCCCTGGGCCGGACCGG + Intergenic
1200094203 X:153649715-153649737 GAGCAGGCCTTGGGGAGGACAGG - Intronic