ID: 1085509655

View in Genome Browser
Species Human (GRCh38)
Location 11:77081837-77081859
Sequence GCACTCAGGTCTGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085509655_1085509658 -6 Left 1085509655 11:77081837-77081859 CCTGCTGCAGCAGACCTGAGTGC 0: 1
1: 0
2: 0
3: 31
4: 217
Right 1085509658 11:77081854-77081876 GAGTGCTGGCGTCTGTGATGTGG 0: 1
1: 0
2: 2
3: 38
4: 177
1085509655_1085509660 13 Left 1085509655 11:77081837-77081859 CCTGCTGCAGCAGACCTGAGTGC 0: 1
1: 0
2: 0
3: 31
4: 217
Right 1085509660 11:77081873-77081895 GTGGAAAGCTGATTCCCCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 104
1085509655_1085509659 12 Left 1085509655 11:77081837-77081859 CCTGCTGCAGCAGACCTGAGTGC 0: 1
1: 0
2: 0
3: 31
4: 217
Right 1085509659 11:77081872-77081894 TGTGGAAAGCTGATTCCCCTTGG 0: 1
1: 0
2: 3
3: 23
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085509655 Original CRISPR GCACTCAGGTCTGCTGCAGC AGG (reversed) Intronic
900224637 1:1527231-1527253 GCTCCCAGGTCAGCTGCTGCCGG + Intronic
902221595 1:14969427-14969449 GCTCTCGGGGCTGCTGCAGGGGG + Intronic
902396675 1:16135684-16135706 ACACTCGGCTCTGCTGCGGCGGG + Exonic
902644914 1:17791276-17791298 GCCATCACGCCTGCTGCAGCAGG - Intronic
903887475 1:26548913-26548935 GCACACAGGGCTGCAGGAGCTGG - Intronic
904028875 1:27521616-27521638 GCAGTCAGGGCTGCCGGAGCCGG + Intergenic
904161742 1:28527121-28527143 GCCCTCAGGCCTGCTGCTTCTGG - Intronic
904303904 1:29574689-29574711 GCATTTATGTCTACTGCAGCTGG + Intergenic
904425445 1:30419808-30419830 CTGCCCAGGTCTGCTGCAGCTGG - Intergenic
906344060 1:45004344-45004366 GCAGGCAGGTCTGCTGAAGGTGG - Exonic
907046502 1:51303171-51303193 GGACTATGGGCTGCTGCAGCTGG - Exonic
907369790 1:53993224-53993246 GCCATCATGTCAGCTGCAGCAGG - Intergenic
907716970 1:56934921-56934943 GCACTGGGGTTTGCTGCAGGAGG + Intronic
908390176 1:63677114-63677136 GAACTCAGTTCTGAGGCAGCAGG - Intergenic
909507299 1:76407828-76407850 TCACTCAGTTCTGCTTCAGTAGG - Intronic
911654478 1:100427769-100427791 ACACTGAGCTCTCCTGCAGCAGG - Intronic
915940661 1:160116376-160116398 GCACTCAGGGCCCCTGGAGCTGG - Intronic
916046440 1:161003507-161003529 GCACTTTGGGCGGCTGCAGCGGG - Intronic
918552936 1:185764999-185765021 GCAATCAGCTGTGGTGCAGCAGG - Intronic
919830245 1:201535849-201535871 GGAGTCAGGTCTTCTGAAGCTGG + Intergenic
919999002 1:202781067-202781089 GCACTTTGGGCTGCAGCAGCAGG + Intronic
920254451 1:204644901-204644923 ACACACAGGCCTGCTCCAGCAGG - Intronic
920391090 1:205602292-205602314 GCACTCAGCTGTGCTGCTGGTGG - Exonic
1063684601 10:8224782-8224804 GCACTGCGGGCTGCTCCAGCAGG - Intergenic
1065419842 10:25530850-25530872 GCTCTCTGGTCTGCTGGAGATGG + Intronic
1065754707 10:28920420-28920442 TCACTCAGGTCTGCTCTATCAGG - Intergenic
1067089499 10:43259388-43259410 GCACTCCAGTCTTCTGCAGAAGG - Intronic
1072625892 10:97111727-97111749 GCTCCCAGGTGAGCTGCAGCAGG - Intronic
1072728457 10:97829080-97829102 GCAGTCAGGGCTGATGAAGCTGG + Intergenic
1073983950 10:109186917-109186939 GCTCTGTGGGCTGCTGCAGCAGG - Intergenic
1074396130 10:113099447-113099469 GCACTGAGGGCTGGTGCAGGCGG - Intronic
1075050077 10:119177083-119177105 GCCCTCAGGCCTGCTGCATGTGG - Exonic
1075731814 10:124640856-124640878 TCACTCTGCTCTGCCGCAGCGGG - Intronic
1076290181 10:129340067-129340089 GCACTCAGGCAGCCTGCAGCGGG + Intergenic
1076648401 10:131970272-131970294 GCACCCAGCTCTGCTGTAGGTGG - Intronic
1078062219 11:8055616-8055638 GGACTCAGCTCTGCTGCTGATGG + Intronic
1079022989 11:16924462-16924484 GGACTCAGGTCTCCTACACCTGG + Intronic
1079757861 11:24288105-24288127 CCACTCAGATCTCCTGCTGCAGG - Intergenic
1079882566 11:25944886-25944908 GGACTCACCTCTGCTGCACCAGG + Intergenic
1080596984 11:33781800-33781822 CCACTCAGATCTCCTGCTGCAGG - Intergenic
1082084666 11:48040033-48040055 GCACTCTGGGAAGCTGCAGCGGG - Intronic
1082254751 11:50021311-50021333 TCTCCCAGGTTTGCTGCAGCAGG - Intergenic
1083242292 11:61397862-61397884 GTACGTAGGTCTGCAGCAGCAGG - Exonic
1083330050 11:61893254-61893276 CCACTCAGGGCTGCTGAAGGTGG - Intergenic
1083641159 11:64146146-64146168 ACACACAGGTCTGGTGCACCAGG + Intronic
1083889916 11:65590578-65590600 GCACTCACAGCAGCTGCAGCTGG - Exonic
1085509655 11:77081837-77081859 GCACTCAGGTCTGCTGCAGCAGG - Intronic
1085859460 11:80214851-80214873 TCACAAGGGTCTGCTGCAGCTGG + Intergenic
1089080967 11:115775963-115775985 GCCCTCTCGTATGCTGCAGCTGG - Intergenic
1089636187 11:119813763-119813785 GCACTCAGTTCTGCCGGAGTGGG + Intergenic
1090384395 11:126348171-126348193 GCACTCAGGTCTGGAGAGGCAGG + Intergenic
1090681140 11:129058577-129058599 CCCCTCAGGGCTGCTGCAGAAGG + Intronic
1091836238 12:3588072-3588094 GCACCCAGGCCTGCTTCTGCTGG - Intronic
1101915585 12:108893171-108893193 GCACTCAGGTATTCTGAAGGAGG + Intronic
1102356072 12:112237057-112237079 GCACTCAGGTCTGGCCCGGCAGG - Exonic
1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG + Intronic
1106776504 13:33015497-33015519 GCGCACAGGTCTGCTGGAGCGGG - Intergenic
1108245072 13:48505895-48505917 GCCCACAGTTCTGCAGCAGCTGG - Intronic
1108508362 13:51133709-51133731 GCACTGAGGTCTGATGCACATGG + Intergenic
1109967494 13:69720476-69720498 GCACTCAATTCTGCTGAAACAGG + Intronic
1114174273 14:20305688-20305710 GCAGTCAGGTCGGCAGCAGGAGG + Intronic
1116860941 14:49995202-49995224 GGACTCAGGGCAGGTGCAGCTGG - Intronic
1119709034 14:76808008-76808030 GCTCTGAGCTCTGCTGCATCAGG + Exonic
1122584302 14:102794052-102794074 GCTCTCAGGTCCTCTGCAGATGG + Intronic
1125435879 15:39645273-39645295 GCCATCATGTCAGCTGCAGCAGG + Intronic
1126913340 15:53437872-53437894 GCAGTCAGGAATGCTGCAGAGGG + Intergenic
1128077920 15:64839916-64839938 GGTCTCTGGTCTGCTGCAGGTGG + Intergenic
1128242906 15:66113536-66113558 GTACTCAGGGCTTCTGCTGCGGG - Intronic
1128847706 15:70916643-70916665 GCCATCAGGCCAGCTGCAGCAGG + Intronic
1129118564 15:73380625-73380647 CCTCTCAGGCCTGCTGTAGCTGG - Intergenic
1129510466 15:76117977-76117999 GTTCTCAGGCCTGCTGCAGCTGG + Intronic
1129976938 15:79830610-79830632 GAGCTCAGGGCAGCTGCAGCAGG - Intergenic
1130007506 15:80114297-80114319 GGAGTCAGGTCGGCAGCAGCTGG - Intronic
1130348072 15:83067123-83067145 TCACTCGGGCCTGCCGCAGCTGG - Exonic
1132675562 16:1119908-1119930 GGCCCCAGGCCTGCTGCAGCGGG - Intergenic
1132868672 16:2105921-2105943 GCTCCCAGGGCTGCTGCGGCAGG - Exonic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1133830778 16:9321553-9321575 ACACTGAGGTCAGCTGCAGTGGG - Intergenic
1135770861 16:25217368-25217390 GGACACTGGGCTGCTGCAGCCGG + Exonic
1136144633 16:28309193-28309215 GCACTCTCTTCTTCTGCAGCTGG - Intronic
1136482907 16:30553808-30553830 GCACTCAGGTTTTCTGGAGTTGG - Exonic
1137359742 16:47803098-47803120 GCTAGCAGGTCTGCTGGAGCTGG + Intergenic
1139307583 16:66000577-66000599 GCAATCAGGTGTGCTGCACTAGG - Intergenic
1139505412 16:67395971-67395993 GGACTCAGCTCTGCGGGAGCTGG - Intronic
1139921048 16:70460884-70460906 ACCCTCAGGTCAGCTGCAGCAGG - Intronic
1139921206 16:70461605-70461627 GCACTCAGAGCTGCAGGAGCAGG - Intronic
1142187672 16:88702110-88702132 GCACTCCGGGCTCCAGCAGCAGG + Intronic
1143103842 17:4518799-4518821 GAACCCAAGTCTGCTGAAGCAGG - Intronic
1147512609 17:41084346-41084368 GCACTGGGGCCTGCAGCAGCTGG - Exonic
1147513906 17:41097923-41097945 GCACTGGGGTCTGCAGCAGCAGG + Exonic
1147514378 17:41101931-41101953 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147514400 17:41102051-41102073 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147514777 17:41105528-41105550 GCACTGGGGCCTGCAGCAGCTGG - Exonic
1147514800 17:41105648-41105670 GCACTGGGGCCTGCAGCAGCTGG - Exonic
1147515973 17:41117944-41117966 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147516006 17:41118154-41118176 GCACTGGGGCCTGCAGCAGCTGG + Exonic
1147516596 17:41123733-41123755 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147516617 17:41123853-41123875 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147516638 17:41123973-41123995 GCACTGGGGCCTGCAGCAGCTGG + Exonic
1147517978 17:41140206-41140228 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147518000 17:41140338-41140360 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147518897 17:41149438-41149460 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147519831 17:41160287-41160309 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147519843 17:41160362-41160384 GCACTGGGGCCTGCAGCAGCTGG + Exonic
1147519864 17:41160467-41160489 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147519878 17:41160542-41160564 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147521522 17:41177895-41177917 GCACTGGGGTCTGAAGCAGCTGG + Exonic
1147521540 17:41178015-41178037 GCACTGCGGTCTGCAGCAGCTGG + Exonic
1148053616 17:44780920-44780942 GCTCTCAGGCTCGCTGCAGCAGG - Exonic
1148441999 17:47716267-47716289 GTACTCAGGCCTGCTGAACCGGG - Intergenic
1150359392 17:64517778-64517800 GCACTCTGGGAGGCTGCAGCAGG - Intronic
1152650354 17:81489647-81489669 GAGCTCAGGTCCGCAGCAGCAGG - Intergenic
1155120870 18:22817037-22817059 GCCATCACGTCGGCTGCAGCAGG - Intronic
1155718177 18:28972752-28972774 GCAGTCAGGGCTGATGCTGCAGG - Intergenic
1156026615 18:32662135-32662157 CCACTCAGATCTCCTGCAGAAGG + Intergenic
1157398919 18:47369940-47369962 ACATTGAGGTCTGCTGCTGCAGG - Intergenic
1159013332 18:63080518-63080540 TCAGTCTGCTCTGCTGCAGCTGG + Intergenic
1159048591 18:63395071-63395093 GCTGAGAGGTCTGCTGCAGCTGG + Intronic
1160535753 18:79590437-79590459 GGACTCTGTCCTGCTGCAGCAGG + Intergenic
1160861792 19:1240258-1240280 TCACGCAGGTCTGCGGCACCCGG - Intergenic
1163008326 19:14409981-14410003 TTACTGAGGTCTGGTGCAGCAGG - Intronic
1163249843 19:16120130-16120152 CCACTCATGTCTCCTGCTGCTGG + Intronic
1163956272 19:20644289-20644311 GCAGTCAGGTCTGCAGATGCTGG - Intronic
1165882054 19:39051281-39051303 GCTCTCCGGTCAGCTACAGCTGG - Intergenic
1165931059 19:39359051-39359073 GAACCCAGCTCAGCTGCAGCAGG + Intronic
1167363428 19:49042429-49042451 GGACTCAGGTGTGCTGGAGGTGG + Intergenic
1168645862 19:58059150-58059172 GCTCTCAGTGCTGCTGGAGCTGG - Intergenic
929925857 2:46207930-46207952 TCTCTCAGGCCTGCTGCACCTGG + Intergenic
930716704 2:54600137-54600159 GCACACAGGCCTACTGCGGCTGG - Intronic
931300276 2:60972957-60972979 GCCATCAAGCCTGCTGCAGCCGG + Intronic
932041475 2:68304140-68304162 GCACTTTGGGATGCTGCAGCAGG + Intronic
936077758 2:109412514-109412536 GCACTCTGCTCTGCAGCAGCGGG - Intronic
937815186 2:126243540-126243562 GGACTCAGGACTGCTCCAGCTGG - Intergenic
937868899 2:126773641-126773663 GCTCTCAGGACTGCTGCTGAGGG - Intergenic
938672645 2:133600512-133600534 GCAGTCAGCTCTGCTCCAGTGGG - Intergenic
942516976 2:176764452-176764474 GCACGCAGCTTTTCTGCAGCAGG - Intergenic
945253247 2:207782377-207782399 GCACTTTGGCCTGCTGCAGCAGG - Intergenic
945473167 2:210250714-210250736 ACTCTCATGTCTGCTTCAGCTGG - Intergenic
946474772 2:219996582-219996604 CTACTCAGCTCAGCTGCAGCAGG + Intergenic
948346796 2:237305501-237305523 AAACTCAGGTCTGCACCAGCTGG - Intergenic
1170969559 20:21104551-21104573 GCAACCAGGTCTGCAGCCGCTGG + Intergenic
1171385979 20:24769820-24769842 CCACTCTCGTCTGCTGCTGCCGG + Intergenic
1172042155 20:32052958-32052980 ACACCCAGGCCGGCTGCAGCTGG + Intronic
1173555444 20:43962270-43962292 GCCCTCTGGGCAGCTGCAGCTGG + Intronic
1175526372 20:59637206-59637228 GGACTCAGGGCTGCTGGAGCTGG + Intronic
1176382129 21:6118833-6118855 GCACCAAGGTCTGCGGCTGCGGG - Exonic
1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG + Intergenic
1179741343 21:43419406-43419428 GCACCAAGGTCTGCGGCTGCGGG + Exonic
1179888505 21:44324673-44324695 GCCGGCAGGTCTGCCGCAGCAGG - Intronic
1179939249 21:44627599-44627621 GCACACAGGTTTGCAGCAGACGG - Exonic
1179983984 21:44911012-44911034 GCACCCAGGACAGCTGCAGCGGG + Intronic
1181097772 22:20517657-20517679 CCTCTCAGGACTGCTGTAGCAGG + Intronic
1181173163 22:21021640-21021662 GCACTCAGCTCAGGGGCAGCAGG - Intronic
1181467660 22:23118798-23118820 GCCCACAGGTGGGCTGCAGCAGG + Intronic
1181559513 22:23692055-23692077 GCACTCAAGACTGCAGCTGCAGG - Exonic
1182461351 22:30486001-30486023 GTACCCAGGTCAGCTGCCGCTGG - Intergenic
1182805779 22:33068900-33068922 GGACTCAGGGCTGCGGCTGCTGG + Intergenic
1184349734 22:43935822-43935844 CCACTGAGGGCTGCTGCAGTAGG + Intronic
950961401 3:17111740-17111762 GCACTGACGTCTTCTGCAGTGGG - Intergenic
951525319 3:23647659-23647681 CCACTCAGGTCTCCTGCTGCAGG - Intergenic
952674711 3:36013688-36013710 CCTCTCAGGTCTGCAGCTGCAGG - Intergenic
955630062 3:60963947-60963969 GAACTCAGCTCTGCAGCAGGTGG - Intronic
957482119 3:80811747-80811769 GTAATCAGGTCTGCTGAAACAGG + Intergenic
959694225 3:109232159-109232181 GCACAGAGTTCTGCTCCAGCAGG + Intergenic
960047502 3:113212002-113212024 TGACTCACCTCTGCTGCAGCCGG - Exonic
961372708 3:126441140-126441162 GTGCTCAGGGCTGCTGAAGCAGG + Intronic
961689715 3:128660179-128660201 GCACTCTGGGAGGCTGCAGCGGG + Intronic
961869645 3:129978027-129978049 GTTCTCAGCTCTGCTGCAGAGGG + Intergenic
962181051 3:133206873-133206895 ACACTTAAGTCTGCTGAAGCTGG + Intronic
965181926 3:165415044-165415066 GCACACTTGTCAGCTGCAGCGGG - Intergenic
966835442 3:184046079-184046101 GCACTGCGGTCTGCAGCAGGTGG - Intergenic
966934635 3:184697902-184697924 GCCCACAGGGCTACTGCAGCAGG + Intergenic
967778403 3:193408540-193408562 CCACTCAGATCTTCTGCTGCTGG + Intronic
968463792 4:739587-739609 GCACCCAGGTCCACTGCCGCAGG - Intronic
968832078 4:2937630-2937652 GCCCTCAGGTGTGCTGGACCCGG - Intergenic
969102457 4:4779317-4779339 CCACTCAGCTCTGCGACAGCAGG - Intergenic
969317960 4:6393587-6393609 GCACCCAGCTCTGCTACTGCAGG + Intronic
973532586 4:51847748-51847770 GCACTGAGGGCAGCTGGAGCCGG - Intronic
976455040 4:85236623-85236645 GCTCTGAGGTGTTCTGCAGCTGG + Intergenic
976481046 4:85545506-85545528 ACTATCAGGTATGCTGCAGCAGG + Intronic
977471725 4:97451925-97451947 GCCATCAGGTATGCTGCACCAGG + Intronic
979512277 4:121567857-121567879 ACACTTAAGTCTGCTGAAGCTGG - Intergenic
982659502 4:158190186-158190208 GCAGTAAGGTCTGCTGCTTCAGG - Intergenic
985581277 5:696379-696401 GCACTGAGGTGTCCTGCAGCTGG + Intergenic
985595905 5:787711-787733 GCACTGAGGTGTCCTGCAGCTGG + Intergenic
985899973 5:2780642-2780664 GGACTCAGGGCTTCTGGAGCTGG - Intergenic
990347605 5:54884861-54884883 CCACTCAGGTCTGCGGCTACTGG + Intergenic
990972876 5:61528832-61528854 GCACTCTGGGATGCTGAAGCGGG - Intronic
991374143 5:65948421-65948443 GCACTTTGGGATGCTGCAGCAGG - Intronic
994725789 5:103434133-103434155 GCCCTCATGCCGGCTGCAGCAGG + Intergenic
995226192 5:109704124-109704146 GGACTCATGACTACTGCAGCTGG - Intronic
997338019 5:133121588-133121610 GCACCGAGCTCTGCTGTAGCAGG + Intergenic
997866987 5:137472485-137472507 GCACTCACGTGTGCTGCTGGTGG + Intronic
999093623 5:148958749-148958771 GTACCCAGGCCTGCAGCAGCTGG + Intronic
999323777 5:150630632-150630654 CCACTCAGGTCTCCTGCTGGGGG + Intronic
1001087438 5:168710947-168710969 GGGCTCAGGGCTACTGCAGCGGG + Exonic
1002638630 5:180620106-180620128 GCACTCCGGCCTGCAGCAGGTGG + Intronic
1006550819 6:34821781-34821803 TCACTCGGGTCTACTGCAACAGG + Exonic
1006706970 6:36028478-36028500 GCACTCAGGTCCGCTGCGAGAGG + Intronic
1007395970 6:41578009-41578031 GGCCTGAGGCCTGCTGCAGCAGG - Exonic
1007618970 6:43200042-43200064 GCACTCAGCTCAGCTGCTGCTGG + Exonic
1012341337 6:98128675-98128697 CCACTCAGGTGTGTTGTAGCAGG + Intergenic
1013709538 6:112880447-112880469 GCCCTCCTCTCTGCTGCAGCCGG + Intergenic
1018478295 6:164165299-164165321 ACACTCTGGTTTGCTACAGCAGG + Intergenic
1019171352 6:170134902-170134924 GCTCTCAGATCTGCAGCTGCTGG - Intergenic
1020051609 7:5085627-5085649 GCACTCAGAACTGCATCAGCAGG + Intergenic
1020134738 7:5580914-5580936 GCACCCAGGTCTCCCGCACCTGG + Intergenic
1022479727 7:30734833-30734855 GCTCTCAGGGAAGCTGCAGCAGG - Intronic
1023190485 7:37575594-37575616 GCACTCTGGGAGGCTGCAGCCGG + Intergenic
1024315218 7:48009818-48009840 GCACTCTGGTCTGCAGTACCGGG + Intronic
1024613148 7:51084263-51084285 GCCCTAAGGTCTGCAGCTGCAGG - Intronic
1025074447 7:55930804-55930826 GCACTCAGCTCTGCTGTTGCAGG - Intronic
1026359785 7:69592161-69592183 GCCATCATGCCTGCTGCAGCAGG - Intergenic
1029694732 7:102205142-102205164 TCACACAGCCCTGCTGCAGCGGG - Exonic
1034864713 7:154631227-154631249 CCATTCGGGTCTGCAGCAGCAGG + Intronic
1035204692 7:157287530-157287552 GCACTCAGCTCTTGTCCAGCTGG + Intergenic
1035695238 8:1591078-1591100 GCACCCAGTTCTGCAGCTGCCGG - Intronic
1036061917 8:5332275-5332297 GGACTCAGGTCTGCTGCACATGG - Intergenic
1037368335 8:18146396-18146418 ACACTCAGAACTGCTGCTGCTGG + Intergenic
1038191747 8:25328078-25328100 GCATTCTGGTCTTCTGCAGCTGG + Intronic
1038538991 8:28375659-28375681 GCTCAGAGTTCTGCTGCAGCCGG - Intronic
1039633425 8:39137517-39137539 GCACTTAGGTATGCTGAGGCAGG + Intronic
1041152686 8:54953146-54953168 GCACTTAGGTTTCCTGCTGCAGG - Intergenic
1041975514 8:63794737-63794759 CCACTCAGATCTCCTGCTGCAGG - Intergenic
1043738402 8:83775729-83775751 GCACTCCTGTTGGCTGCAGCAGG - Intergenic
1043823795 8:84900891-84900913 GAACTCAGCTCTGCTGAAACAGG + Intronic
1046631844 8:116629472-116629494 CCACTCAGGTCTCCTGCTGTAGG + Intergenic
1047314373 8:123718848-123718870 GCAATCTGCTCTGTTGCAGCAGG - Intronic
1048931630 8:139319903-139319925 GCCCTCAGGCCTGCAGCAGTCGG + Intergenic
1049436338 8:142587800-142587822 CCAGTCAGCTCTGCTGCAGCGGG - Intergenic
1049745196 8:144260323-144260345 GCGCTCAGGGCTGCTGCACGTGG + Exonic
1055648064 9:78379425-78379447 GAACTCAACTCTGCTGAAGCAGG + Intergenic
1058958685 9:109972493-109972515 GCTCTGAGGTCTGGTGCATCTGG + Intronic
1059338581 9:113584250-113584272 GCCCTCGGGGCTCCTGCAGCAGG - Exonic
1059447673 9:114348926-114348948 GCGCTCATGTCTGCTGGAGGCGG - Intronic
1059565383 9:115379444-115379466 GCCATCATGCCTGCTGCAGCAGG + Intronic
1059612459 9:115913770-115913792 GCATTAAGGTCTGCTGCTGGTGG - Intergenic
1061975409 9:134065886-134065908 GCAGCCAGGCCTGCTGCAGCCGG - Intronic
1062077110 9:134595403-134595425 GAACTCAGGTCTGCCCCAGGTGG - Intergenic
1062133088 9:134910673-134910695 GCACTGAGAATTGCTGCAGCTGG - Intronic
1062167491 9:135115234-135115256 CCACTCAGGTCTGCAGCTTCAGG + Intronic
1062600040 9:137315483-137315505 GCCCCCAAGTCTGCTGCAACAGG - Intronic
1185877608 X:3713260-3713282 GCACTCAGGTCCGGGGCACCGGG + Exonic
1186444771 X:9617898-9617920 GCACTGTGGTCAGCTGGAGCTGG + Intronic
1186705943 X:12139037-12139059 GCACCCAGGGCCGCTGCCGCGGG + Intronic
1188493135 X:30756615-30756637 GCACACAGCTCCGCTGCTGCTGG + Intergenic
1189037028 X:37504452-37504474 TCACCCATGTCTGCTGCACCCGG - Intronic
1194379257 X:93174715-93174737 AGGCTCAGGTCTGCAGCAGCAGG - Intergenic
1199750878 X:150816353-150816375 GCACCCAGATCTGCTGGAGATGG + Intronic