ID: 1085509861

View in Genome Browser
Species Human (GRCh38)
Location 11:77082721-77082743
Sequence CCTTCCATCCTCCCCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 380}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085509849_1085509861 11 Left 1085509849 11:77082687-77082709 CCCAGCCGAGCTCTCCCTTTATG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509854_1085509861 -4 Left 1085509854 11:77082702-77082724 CCTTTATGGCCTCCACCTCCCTT 0: 1
1: 0
2: 2
3: 21
4: 304
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509850_1085509861 10 Left 1085509850 11:77082688-77082710 CCAGCCGAGCTCTCCCTTTATGG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509845_1085509861 27 Left 1085509845 11:77082671-77082693 CCTGTGCAGCCCCTGGCCCAGCC 0: 1
1: 0
2: 10
3: 93
4: 820
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509848_1085509861 16 Left 1085509848 11:77082682-77082704 CCTGGCCCAGCCGAGCTCTCCCT 0: 1
1: 0
2: 2
3: 60
4: 505
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509852_1085509861 6 Left 1085509852 11:77082692-77082714 CCGAGCTCTCCCTTTATGGCCTC 0: 1
1: 0
2: 1
3: 24
4: 198
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509847_1085509861 17 Left 1085509847 11:77082681-77082703 CCCTGGCCCAGCCGAGCTCTCCC 0: 1
1: 0
2: 2
3: 39
4: 351
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509846_1085509861 18 Left 1085509846 11:77082680-77082702 CCCCTGGCCCAGCCGAGCTCTCC 0: 1
1: 0
2: 4
3: 33
4: 361
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509853_1085509861 -3 Left 1085509853 11:77082701-77082723 CCCTTTATGGCCTCCACCTCCCT 0: 1
1: 0
2: 2
3: 41
4: 360
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380
1085509844_1085509861 28 Left 1085509844 11:77082670-77082692 CCCTGTGCAGCCCCTGGCCCAGC 0: 1
1: 1
2: 9
3: 82
4: 782
Right 1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085509861 Original CRISPR CCTTCCATCCTCCCCAGGAG TGG Intronic
900106695 1:984394-984416 CCCCCCGCCCTCCCCAGGAGGGG - Intergenic
900361795 1:2292731-2292753 CCTCACGTCCTCCCCAGCAGGGG - Intronic
900673506 1:3870069-3870091 CGTTCCAGCCTCCCCAGCAGGGG - Intronic
901036284 1:6338219-6338241 CCATCCCTCCTCTCCAGGAAGGG + Intronic
901194479 1:7432801-7432823 CCTTTCAGCTTCACCAGGAGAGG + Intronic
901366518 1:8755562-8755584 CCTTTCAACCTCCCCAGAGGTGG - Intronic
901873174 1:12150501-12150523 CCTGCCCTCTTCCTCAGGAGAGG - Intergenic
903212994 1:21829074-21829096 CCTGGCATCCTCCCCAGGGCTGG - Exonic
905302337 1:36993949-36993971 CCTCCCTTCTTCCCCAGGGGAGG + Intronic
905380163 1:37556267-37556289 CCTTCATCCCTCCCCAGAAGAGG + Intergenic
905532662 1:38694497-38694519 CACTCCATCCTCCCCAACAGAGG + Intergenic
906915439 1:50004508-50004530 CCTTCCTTCCTCCAGAGGAGAGG + Intronic
908124106 1:61013288-61013310 TCTTCCACACTCCCAAGGAGTGG - Intronic
908848792 1:68352443-68352465 CCTTCCCTCCTCTTCAGAAGTGG - Intergenic
910193838 1:84621000-84621022 CCTTCTGTCCTCCACCGGAGAGG + Intergenic
910262523 1:85306054-85306076 ACTTTCATCCTCCCCTGGAAGGG + Intergenic
910843764 1:91586097-91586119 GCTTCCGTCCTCTCCTGGAGAGG - Intergenic
915341369 1:155178653-155178675 CTTCCCTTCCTCCCCAGCAGCGG + Intronic
915936096 1:160091179-160091201 CATGCCACCCACCCCAGGAGGGG - Intergenic
916501723 1:165393163-165393185 CCGCCCAGCCTCCCCAGGGGAGG - Intergenic
916573584 1:166048137-166048159 CTTTCCTCCTTCCCCAGGAGAGG + Intergenic
917597470 1:176543652-176543674 CCTTCCACCATCCCCAGGTGTGG - Intronic
918243645 1:182640966-182640988 CCTTCCACTCTCTCCTGGAGGGG + Intergenic
919795006 1:201316365-201316387 CCTTCCCTCCTCTGGAGGAGAGG + Intronic
920202415 1:204267762-204267784 CCTGTTATCCTCCCCAGGGGAGG - Intronic
920406587 1:205718277-205718299 CTTTTAATCCTCCCCAGAAGGGG + Exonic
920513202 1:206565828-206565850 CCCTCCATCCTCCTCAGTGGTGG - Intronic
920549518 1:206846790-206846812 CCTTCCTTCCACTTCAGGAGTGG + Intergenic
921910851 1:220547412-220547434 TCTACCTTCCTCTCCAGGAGGGG + Intronic
922462593 1:225824708-225824730 CCCTCCGTCCTCCCCAGGGTGGG + Intronic
922513226 1:226186769-226186791 CCCTCCAGCCTCCTCAGCAGCGG - Intergenic
922645686 1:227284486-227284508 CCCACCACCATCCCCAGGAGAGG + Intronic
923657341 1:235929526-235929548 CTTTCCATCCTCCAGAGCAGAGG - Intergenic
923955087 1:239007948-239007970 CCTCCCAGCCTCCCGAGTAGTGG - Intergenic
924863483 1:247952230-247952252 CTTTCCATCCTTCTCAGGACTGG - Intronic
1062978737 10:1704354-1704376 TCTCCCATCATCCCCAGGTGGGG - Intronic
1063119255 10:3093093-3093115 CCTTCCACACATCCCAGGAGCGG - Intronic
1063525548 10:6781324-6781346 CCTTCCATCATCCCTGGGAGGGG - Intergenic
1063607881 10:7538975-7538997 CCTTCCATCTGTCCCAGGAAGGG + Intergenic
1064415361 10:15144750-15144772 CTCTCCATCCTCCCCAGCACTGG - Intronic
1064869706 10:19923948-19923970 CCCTTCAGCCTCCCAAGGAGTGG - Intronic
1065426941 10:25615808-25615830 CTTTCCTTCCTCCTGAGGAGAGG - Intergenic
1066461820 10:35619132-35619154 GCCTCCCTCCTCCCCAGGCGAGG - Intergenic
1067083728 10:43227491-43227513 TCTTTCAGCTTCCCCAGGAGAGG - Intronic
1069933649 10:71900462-71900484 CCTTCCCTCCTCTTGAGGAGAGG - Intergenic
1070487248 10:76942852-76942874 GGTTCACTCCTCCCCAGGAGAGG + Intronic
1070599717 10:77857209-77857231 CCTTGCATCCTCCCCTGGTTTGG + Intronic
1070935757 10:80293669-80293691 GCTCCCACCCTCCCCAGGTGGGG - Intergenic
1070954346 10:80454500-80454522 CCTCCCCGCCTGCCCAGGAGCGG + Intronic
1071750694 10:88472165-88472187 CCTTCCTTCCTGCCCAGGGCTGG + Intronic
1073009846 10:100350556-100350578 CCTTCTCTCCTCCCCAGGGGAGG - Intronic
1076099770 10:127766747-127766769 CCTTCCACCCAGCCCAGGTGGGG - Intergenic
1076264447 10:129098878-129098900 GGTTCCAACCTCCCCAGGAATGG + Intergenic
1076408000 10:130226202-130226224 CCTTCCAGGATCCCCGGGAGGGG - Intergenic
1077138790 11:1014452-1014474 ACTTCCCTCCTCCCCAGCTGGGG - Intronic
1077185184 11:1232567-1232589 CCACCCATCCTGCCCAGGCGTGG - Intronic
1077333474 11:1993467-1993489 TCTTCCATGTTCTCCAGGAGAGG + Intergenic
1077352031 11:2097515-2097537 CCTCCCAGCCTCCCCCGCAGCGG - Intergenic
1077560722 11:3258528-3258550 ACTGTCTTCCTCCCCAGGAGGGG + Intergenic
1077566618 11:3304356-3304378 ACTGTCTTCCTCCCCAGGAGGGG + Intergenic
1078329760 11:10409584-10409606 CTCTCCATCCTGCCCAGGAAGGG - Intronic
1079041888 11:17067016-17067038 TCTGCCATCCTCCCCAACAGGGG + Intergenic
1079099274 11:17530858-17530880 CCTCCCCTACTCCCCAAGAGAGG - Intronic
1080878281 11:36296354-36296376 CCTTCCAGCCTCCCGAGAAGGGG - Intronic
1083150810 11:60790724-60790746 TCTGCCATTCTCCCCAGGACAGG - Intronic
1083792470 11:64994758-64994780 CCTCCCACCCTCCACATGAGCGG - Intronic
1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG + Intronic
1085562727 11:77487041-77487063 CCTTCCTTCCACCTGAGGAGAGG + Intergenic
1085771642 11:79331016-79331038 CCCTCCTTCCTGGCCAGGAGAGG - Intronic
1085980471 11:81718271-81718293 CCTTCCTTCCACCTGAGGAGAGG + Intergenic
1087057702 11:93949744-93949766 CTTTCCATCCTCCTGAGGACTGG - Intergenic
1089310592 11:117555857-117555879 CCCTCCATACTCTGCAGGAGAGG - Intronic
1089354633 11:117841683-117841705 CCTCCTTTCCTCTCCAGGAGAGG + Intronic
1089951960 11:122536235-122536257 CCTTCACTCCTCCCTAGTAGAGG - Intergenic
1090136420 11:124204033-124204055 CCTTCCTTCCACCTGAGGAGAGG - Intergenic
1090857474 11:130623056-130623078 CCTCCCATCCTTCCCAGCCGGGG - Intergenic
1202816452 11_KI270721v1_random:48649-48671 TCTTCCATGTTCCCCAGGAGAGG + Intergenic
1091691984 12:2603564-2603586 CTGTCCATCCTACCCAGGTGGGG - Intronic
1091917275 12:4278743-4278765 CCTGCCTTCCCCTCCAGGAGTGG + Exonic
1092497581 12:9012213-9012235 CCTTCCTTCCACCTGAGGAGAGG + Intergenic
1092985140 12:13837896-13837918 CCTCCCTGCCTCCCTAGGAGCGG + Intronic
1095485382 12:42679082-42679104 CCTTCATCCCTCCCCAGAAGAGG - Intergenic
1095638311 12:44457074-44457096 CAGTCCATGCTCCTCAGGAGTGG + Intergenic
1096553835 12:52391204-52391226 TCCCCCTTCCTCCCCAGGAGAGG - Intergenic
1096670305 12:53194464-53194486 CCTTCCATTCTGCCCAGTCGAGG + Exonic
1096674209 12:53217736-53217758 ACCCCCATCCTCCCCAGCAGGGG - Intronic
1096786085 12:54018097-54018119 CCTTCCATCCGCCCGAGTGGGGG - Intronic
1097301490 12:58023716-58023738 CCCTCCCTCCACCCCAGGACAGG - Intergenic
1099590021 12:84575242-84575264 CCATCCTTCCTCACCAGGTGGGG + Intergenic
1100478917 12:94959405-94959427 CCCTCCAGCCTCCCCAGGTGGGG + Intronic
1100729570 12:97449422-97449444 CCTTTCCTCCTCCCCAAGACAGG + Intergenic
1101039358 12:100738188-100738210 CCTGCCTCCCTCCCCAAGAGGGG + Intronic
1101945658 12:109134411-109134433 TCCTACATCCTCCCCAGGAAAGG - Intronic
1102492570 12:113297940-113297962 CCCTTCTTCCTCCCCAGGGGTGG + Exonic
1103037970 12:117671811-117671833 CCATCCTGCCTGCCCAGGAGTGG + Intronic
1103561547 12:121795568-121795590 CCTGCCAGGCTCCACAGGAGTGG + Intronic
1104646133 12:130498725-130498747 TCTTCCAGCCATCCCAGGAGAGG + Intronic
1104936155 12:132365448-132365470 CCTTCCTCCCTCTCCAGGAGTGG - Intergenic
1105310767 13:19207992-19208014 CCTTCCATCTTACCAAGTAGCGG - Intergenic
1106956367 13:34942793-34942815 TCTTCCCTTCTCCTCAGGAGGGG + Exonic
1107150458 13:37105294-37105316 GCCTCCATCCTCCCCTAGAGGGG - Exonic
1108223857 13:48267141-48267163 CCTTTCATGCTTCCCAGCAGGGG - Exonic
1108286175 13:48910273-48910295 CCTTTCATACTCCCAAAGAGTGG + Intergenic
1108336188 13:49444284-49444306 CCTTCCCTCATCCCCGGTAGAGG + Intergenic
1109811490 13:67519009-67519031 CCTACCGTTCTCCCCAGGAGGGG - Intergenic
1111434743 13:88192058-88192080 CCCTCCACCCACCCCAGGACAGG + Intergenic
1111801564 13:92987217-92987239 CCTTCTATCCTACCCAGGTCTGG - Intergenic
1114080283 14:19197851-19197873 CCTGCCATCCTCCTCAGCTGGGG - Intergenic
1114479335 14:23022417-23022439 CCTCCCGTGCTCCCCAGGCGTGG - Intronic
1114766785 14:25381641-25381663 ATTTCCCTCCTCCCCAGTAGGGG + Intergenic
1115708127 14:36019136-36019158 CCTTTCAGACTCTCCAGGAGTGG + Intergenic
1115948596 14:38694288-38694310 CCTTCCCTCCACTCGAGGAGAGG + Intergenic
1117327363 14:54681882-54681904 CTTTCCATCCTCCAGAGCAGTGG - Intronic
1117521585 14:56556908-56556930 TCTTCCTTTCTCCCTAGGAGAGG + Intronic
1118034228 14:61849218-61849240 CCTTCCTTCTGCCTCAGGAGAGG - Intergenic
1118307017 14:64663267-64663289 GCTTCCCTCCTTCCCATGAGAGG + Intergenic
1119159323 14:72440017-72440039 CCTTACACCCTCCCCAGCTGTGG + Intronic
1119308553 14:73627765-73627787 CTTTCCCTCCTCCCCAGGTTTGG + Intergenic
1119379486 14:74219497-74219519 CCTCCCAGCATCCCCAGGCGCGG + Intergenic
1120711484 14:87797809-87797831 CCTGCCTTCCTCTCCAGTAGTGG + Intergenic
1120827266 14:88967308-88967330 CCTTTAATCCTCCACAGGTGAGG - Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121488934 14:94344020-94344042 CCTTCCCTCCCCACCAGGAGTGG + Intergenic
1122481587 14:102050844-102050866 CCTTCCATGCTGCCCAGGGAGGG + Intergenic
1122485155 14:102074415-102074437 CCTTCCCTCCTCCCCAAGCTTGG + Intergenic
1122830245 14:104392449-104392471 CCTTGCTGCCTCCCCAGGATGGG + Intergenic
1122840939 14:104462200-104462222 CCCTCCAGCCCCCACAGGAGAGG + Intergenic
1122865466 14:104602002-104602024 TGTTCCATCCTCCCAAGGGGTGG - Intronic
1123476664 15:20595964-20595986 CTTCCCACCTTCCCCAGGAGAGG - Intergenic
1123641347 15:22404400-22404422 CTTCCCACCTTCCCCAGGAGAGG + Intergenic
1124844331 15:33275734-33275756 CCTTCCATCCACCTGGGGAGAGG - Intergenic
1125276194 15:37994788-37994810 CCTTCCTTCCTTCCCAGAACTGG - Intergenic
1125534034 15:40432729-40432751 CATTCCATCCTCCCAAGGCCAGG - Intronic
1127375621 15:58382023-58382045 CCCTCCCTCCTTCCCAGAAGAGG - Intronic
1128377897 15:67090233-67090255 TCTTCCCACCACCCCAGGAGAGG - Intronic
1129352924 15:74967649-74967671 CCTTCCAGCCACCCCAGCAGAGG - Intronic
1129440409 15:75577897-75577919 CTTCCCATCTTCCTCAGGAGTGG + Intronic
1130893207 15:88150561-88150583 CATTCCATCCACCCAAAGAGCGG - Intronic
1131011475 15:89021697-89021719 CCTTCCTTCCTGCCCAGCAGTGG + Intergenic
1131168749 15:90161569-90161591 CCTCCCAACCTCTCCTGGAGGGG + Intronic
1132199631 15:99942469-99942491 CCTTCCCCCCTCCCCAGAAAGGG - Intergenic
1133699201 16:8293566-8293588 CCCTCCATCTTCCCCAGCACAGG + Intergenic
1135693138 16:24561337-24561359 TGTCCCAGCCTCCCCAGGAGTGG + Intronic
1136504962 16:30697365-30697387 CCTCCCATCACCCCCAGAAGAGG - Intergenic
1137251967 16:46747514-46747536 CCTGCCATTCTCCCCAGGGAAGG - Intronic
1138695082 16:58805322-58805344 TCTTGCCTCTTCCCCAGGAGTGG + Intergenic
1139136878 16:64215430-64215452 CATTCAATGCTTCCCAGGAGTGG + Intergenic
1139281597 16:65775097-65775119 CTTCCCTTCCTCCCCAGGTGTGG - Intergenic
1141691806 16:85600968-85600990 CCTTCCCTCCTCCCACCGAGGGG - Intergenic
1142010786 16:87712792-87712814 TTCTCCAGCCTCCCCAGGAGAGG - Intronic
1142173584 16:88634952-88634974 TCTTCCATCCTCCCCTGGGCGGG + Intergenic
1142484434 17:237426-237448 CCGTCCATCCTTCCCCAGAGGGG - Intronic
1142854845 17:2723920-2723942 GCCTTCTTCCTCCCCAGGAGAGG - Intergenic
1143031200 17:3968193-3968215 CCTTCAGGCCTCCCCAGGGGAGG + Intergenic
1143594463 17:7906191-7906213 CCAGGCATCCTCCCCAGGGGAGG + Intronic
1143779348 17:9221257-9221279 CCTCCCATCCTCCCCAGACAAGG - Intronic
1143917345 17:10303493-10303515 CCTTTCATCCTACTCAGGTGCGG - Exonic
1144740435 17:17579281-17579303 CCTGCCATCCTTCCCACGTGTGG + Intronic
1145885649 17:28380965-28380987 CCCTCCCTCCTCCCCTTGAGAGG - Intronic
1145950327 17:28812301-28812323 TCTTCCATCCTCCCGGGGCGGGG - Intronic
1146110955 17:30089088-30089110 CCTTCCCTCCACCCCACGACAGG + Intronic
1147318297 17:39631552-39631574 CCTCCCAACCTCCGCAGGAGCGG - Intronic
1147393103 17:40122159-40122181 CCCCCCCTCCTCCTCAGGAGGGG - Intergenic
1148578098 17:48725385-48725407 CCCTCACTCCTTCCCAGGAGAGG + Exonic
1149103731 17:52937230-52937252 TCTGCCATACTCCCCAGGAATGG + Intergenic
1151103805 17:71588472-71588494 CCTTCCATCCTCTGTGGGAGTGG + Intergenic
1151164730 17:72193815-72193837 CCTTCGATCCTCCCCTGCAGAGG + Intergenic
1151654629 17:75490174-75490196 CCTTCCCTCCTCCCCAGGCCCGG + Intronic
1152091747 17:78251149-78251171 CCTTCCTTCCTCCCCTGGAGAGG + Intergenic
1152126419 17:78450052-78450074 ACACCCATTCTCCCCAGGAGAGG - Intronic
1152203919 17:78963531-78963553 TCTTCCAGCCACCCCAGGTGAGG + Intergenic
1152246347 17:79186610-79186632 GCCTCCCTCCGCCCCAGGAGCGG - Intronic
1152584239 17:81181973-81181995 CTGTCCATCATCCCCAGCAGCGG + Intergenic
1152895377 17:82907882-82907904 CCTCCCACCCTCCCCAGGCAGGG + Intronic
1153444508 18:5156179-5156201 CCCTCCTTCCTTCCCAGGAAGGG - Intronic
1153465425 18:5382640-5382662 TCTTCCATCCCACCTAGGAGAGG + Intergenic
1153687188 18:7558003-7558025 CCTGCCTTCCTCCACTGGAGAGG + Intergenic
1154177715 18:12095997-12096019 CCTTCCAGACACCCTAGGAGGGG + Intronic
1154936434 18:21062608-21062630 CTTTCCATACTCTCCTGGAGGGG - Intronic
1155889999 18:31255750-31255772 TCCCCCATGCTCCCCAGGAGCGG + Intergenic
1157022691 18:43805698-43805720 CCTTCCATCCACTTGAGGAGAGG - Intergenic
1157276209 18:46312751-46312773 CCTTCCCACCTGCCCAGGGGAGG + Intergenic
1160007050 18:75075431-75075453 CCCTCCATCCTCCCCACGAAGGG - Intergenic
1160124919 18:76163089-76163111 CCTTCCATCCTCTCCACTTGCGG + Intergenic
1160894633 19:1396728-1396750 CCCTCCTCCCGCCCCAGGAGGGG - Intergenic
1160972476 19:1775675-1775697 CCCTCCACCCCCCCCCGGAGGGG + Exonic
1161318784 19:3631598-3631620 CCCTCCACTCTGCCCAGGAGAGG - Exonic
1161959950 19:7517639-7517661 CCATCCCTCCTCACCAGGAGGGG + Intronic
1162266836 19:9582923-9582945 GCCTCCATCCTGGCCAGGAGCGG + Intronic
1162813768 19:13180960-13180982 CCATCTATCCTCCCCAGCAGCGG - Intergenic
1163660979 19:18577283-18577305 CCTTCAATCCCCCCTTGGAGTGG - Exonic
1163846396 19:19640566-19640588 CCATCCATCTTCCCCAGGGGAGG - Exonic
1164442260 19:28288178-28288200 CCTACCCACCTCCCCAGTAGAGG + Intergenic
1165152489 19:33769231-33769253 CCTTCCATCTTCCCCCCGACTGG + Intronic
1165550995 19:36585723-36585745 CTTTCCATACTCCTCAGCAGTGG + Intronic
1166412903 19:42568522-42568544 CCTTCCCTCCACCCCACGACAGG - Intergenic
1166695177 19:44847890-44847912 CCTTCCATCCACCCCACTAGGGG + Intronic
1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG + Exonic
1167048355 19:47064889-47064911 CCTTCCCTCCTCCTCAGGGTGGG - Exonic
1167143643 19:47669390-47669412 CCTTGTATTTTCCCCAGGAGTGG + Intronic
1167561823 19:50230687-50230709 TCTTGCTTCCTCCCCAGAAGGGG - Intronic
1168545822 19:57248875-57248897 ACCTCACTCCTCCCCAGGAGTGG - Intronic
1168615491 19:57833932-57833954 CCTTCCTTCCACTCGAGGAGAGG - Intronic
1168621294 19:57881515-57881537 CCTTCCTTCCACTCGAGGAGAGG + Intronic
925008934 2:467761-467783 CCTTCCTTCCTCCACAAGAAGGG - Intergenic
925255702 2:2485251-2485273 CCCTCCAGCCTCTCCAGGAGAGG - Intergenic
926056897 2:9779007-9779029 CCTTCCAGTCTCCCCCAGAGGGG + Intergenic
926079462 2:9972669-9972691 CATTCCATCCTCACCAGGCACGG - Intronic
927558406 2:24051403-24051425 TCTTCCCTCTCCCCCAGGAGGGG + Intronic
928905992 2:36368224-36368246 CCTTTCATCCTCCCAACGTGAGG - Intronic
929831811 2:45353159-45353181 CCATCTATCCTCCCCAGGCCTGG + Intergenic
930626428 2:53703338-53703360 CTTTCCATCATCCCTGGGAGTGG + Intronic
932175474 2:69596877-69596899 CCTTCTAACGCCCCCAGGAGTGG + Intronic
932436902 2:71707221-71707243 TCTCCCATCTCCCCCAGGAGGGG - Intergenic
932928588 2:76006070-76006092 AATTCCATCCTGCCCAGTAGAGG - Intergenic
934527729 2:95062026-95062048 CCTTCCTTCCTCCCCAGCCACGG + Intergenic
934708060 2:96498432-96498454 TCTTCCAGCCACACCAGGAGAGG - Exonic
934915075 2:98295030-98295052 AGCTCCCTCCTCCCCAGGAGAGG - Intronic
935812890 2:106817310-106817332 CCTTCCTTCCTTATCAGGAGAGG + Intronic
936522497 2:113220046-113220068 CCATCCATCCTGCCCAGCAGAGG + Intronic
936529402 2:113265287-113265309 ACTTCCATCCTCCCCTGGCTTGG - Intronic
937974875 2:127576587-127576609 CCTCCCAGGCTCCCGAGGAGCGG + Exonic
938375000 2:130799135-130799157 CCTGCCCTCCTACCCAGGAGTGG - Intergenic
938689203 2:133771428-133771450 CCTTCCAACAACCCCATGAGTGG + Intergenic
940410744 2:153360638-153360660 CCATCCCTCCTCACCAGGTGGGG + Intergenic
941227619 2:162868283-162868305 CCTTCCTTCCTCTTGAGGAGAGG + Intergenic
943475771 2:188353691-188353713 GCTTCCCTCCTCCCCATGACAGG + Intronic
945175730 2:207041476-207041498 CCATCCCTCCTCCTAAGGAGGGG - Intergenic
945372221 2:209033108-209033130 CAGTCCATCCTCCACAGGTGTGG - Intergenic
946027484 2:216680536-216680558 CCTGCCATCCTGCCCAGGTTAGG - Intronic
946984641 2:225257977-225257999 CCTTCCTTCCACCTGAGGAGAGG + Intergenic
948266363 2:236637942-236637964 CCTTCCCTCCTCCCCAGATCTGG + Intergenic
948469460 2:238167820-238167842 CCTTCCACCCTCTCCAGAGGTGG + Intronic
1169344791 20:4821646-4821668 CCTTCCAGCCTCCCCAGCACAGG + Intronic
1169853570 20:10079015-10079037 TCTTCAATCCTCCCCATGATTGG + Intergenic
1171272652 20:23828599-23828621 CCTTCCATCCTCCCCAATCCTGG - Intergenic
1171524564 20:25798871-25798893 CCTTCCTTTCTAACCAGGAGGGG - Intronic
1171552263 20:26057012-26057034 CCTTCCTTTCTAACCAGGAGGGG + Intergenic
1172013765 20:31861321-31861343 CCTTCCACGCCCCCCAGGACGGG - Exonic
1172221995 20:33280460-33280482 CCTGCCCTCCTCCCTGGGAGAGG + Intronic
1172642199 20:36447150-36447172 CCTCCCATGCCCCCCAGGGGTGG - Intronic
1172702391 20:36861714-36861736 GCTTCCAGCCTCCCAGGGAGAGG + Intronic
1172876929 20:38170066-38170088 CCTTCCAGCCTCACCAGGCATGG + Intergenic
1173021221 20:39269410-39269432 CCTTGCATCTTCCACAGCAGGGG - Intergenic
1173425348 20:42938215-42938237 CATTCCATCCTGTCCAGTAGAGG - Intronic
1174178289 20:48658495-48658517 CCTGCCATCCTGCCCTGGGGTGG - Intronic
1175379821 20:58554995-58555017 CCTTCCCTACTCCCCATGAAGGG - Intergenic
1175824974 20:61931828-61931850 CCCTCCATCCACCCCACAAGGGG + Intronic
1176056835 20:63153231-63153253 GCTTCCATTCTCCCCAGAGGAGG - Intergenic
1176416026 21:6475231-6475253 CCCCCCATCCTTCCCTGGAGAGG + Intergenic
1176914787 21:14611881-14611903 CCTTTCCTTCTCCCCAGCAGAGG - Intronic
1178384774 21:32140204-32140226 CCTTCCCACCTCCACTGGAGAGG - Intergenic
1179029880 21:37711367-37711389 CCTTCCCTCCTCCCTGGAAGAGG + Intronic
1179691526 21:43083565-43083587 CCCCCCATCCTTCCCTGGAGAGG + Intergenic
1179900535 21:44391155-44391177 GCTTTCATCCTCCCCAGGTTGGG + Intronic
1180001704 21:44998131-44998153 CCTTCCAGCCTCCCTGGGACGGG + Intergenic
1180500493 22:15924833-15924855 CCTGCCATCCTCCTCAGCTGGGG + Intergenic
1181636042 22:24175362-24175384 CCCTCCATCCTCTCCAGCAGGGG - Intronic
1182351478 22:29702462-29702484 GTCTCCATCCTCCCCAGCAGGGG + Intergenic
1182360504 22:29743851-29743873 CCTTATATCCACCCCAGGGGAGG + Intronic
1182771916 22:32802206-32802228 CCTTTCCTCTGCCCCAGGAGAGG + Intronic
1183089176 22:35509679-35509701 CCTTCCCTCCTCCCTCGCAGTGG + Intergenic
1183179777 22:36252273-36252295 CCCAGCATCCTCCCCAGCAGAGG - Intergenic
1184355465 22:43976777-43976799 TCTTCCATCTTACCAAGGAGAGG + Exonic
1184606844 22:45579269-45579291 CCTTCCTTCTTCCGTAGGAGGGG + Intronic
1185146948 22:49142597-49142619 ACTCCCATCCTCCCCACAAGCGG - Intergenic
949935494 3:9112617-9112639 CCCTCCGCCTTCCCCAGGAGAGG - Intronic
950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG + Exonic
951075483 3:18386393-18386415 CCAGCCGTCCTCCCCAGGTGCGG - Exonic
952449295 3:33416096-33416118 CCTTCCATCTTCCCACAGAGTGG - Intronic
952652394 3:35741828-35741850 CTTTCCATCCTCTCTAAGAGAGG + Intronic
953585361 3:44196109-44196131 CTTTCCAGCCTCCCCAGCAATGG + Intergenic
953654391 3:44837955-44837977 CTTTGAGTCCTCCCCAGGAGAGG + Intronic
953666374 3:44929023-44929045 CCTTCCATCCCCCCCATGGCAGG - Intronic
953883314 3:46702434-46702456 CCTTTCAGGCTCCGCAGGAGTGG - Intronic
954818008 3:53299286-53299308 CCTTCCATCATCCACAGAAAAGG + Intronic
956094608 3:65702957-65702979 CCTTCCATCATTCTCAGCAGGGG - Intronic
957388047 3:79522548-79522570 ATTTCCATCCACCCAAGGAGAGG + Intronic
958443313 3:94182749-94182771 CCTTCCTTTCTCCCAAGGAAAGG + Intergenic
961499678 3:127323442-127323464 GCTTCCATTCTCCCAGGGAGAGG + Intergenic
961528875 3:127527215-127527237 GCCCCCTTCCTCCCCAGGAGGGG - Intergenic
962367260 3:134794937-134794959 CCTTACATCCCACCCAGGACTGG - Intronic
967086363 3:186098401-186098423 CCTGGCTTCCTCCCCAGGGGAGG + Intronic
968081083 3:195847456-195847478 CCTTCTTTTCTCCCCAGGACAGG - Intergenic
968902146 4:3436823-3436845 CTGTCCAGCCTTCCCAGGAGGGG - Intronic
969516757 4:7652410-7652432 CCTTCCCTTCTCCCCAGGCCTGG + Intronic
969518841 4:7664089-7664111 CCTGCCATCCCCTGCAGGAGGGG - Intronic
969942971 4:10753431-10753453 CTTTCCCTGCTGCCCAGGAGAGG + Intergenic
969947710 4:10801472-10801494 CCTCCCATCCTCACAGGGAGAGG + Intergenic
971264487 4:25085823-25085845 CCAGCCCTGCTCCCCAGGAGTGG + Intergenic
971350537 4:25852038-25852060 CATGCCACCCCCCCCAGGAGAGG + Intronic
971436402 4:26629330-26629352 TCATCCATCCTCCACAGGAGAGG + Intronic
975069591 4:70117833-70117855 CCTTCCCTCCACCCCATGACAGG + Intergenic
975612738 4:76217562-76217584 CCTTTCTGCCTTCCCAGGAGTGG + Intronic
977974317 4:103245990-103246012 CCTTCCCACCTCCCCTGGATAGG - Intergenic
981290668 4:143071340-143071362 CCATCCCTCCTCACCAGGTGAGG - Intergenic
981848639 4:149201017-149201039 CCTTGCCTCCTCCCCAGGACTGG - Intergenic
984433513 4:179679802-179679824 CCTTCCGTCCACCCCACGACAGG + Intergenic
985528570 5:420633-420655 CCTTCCATCCTCTCCACATGGGG - Intronic
985781820 5:1875636-1875658 CCCTGGGTCCTCCCCAGGAGAGG + Intergenic
986344027 5:6817799-6817821 CCCTCCCTCCACCCCAGGACAGG + Intergenic
989170392 5:38467031-38467053 CCATCCTTCCTCCCTAGGACAGG - Intergenic
990667665 5:58091991-58092013 CTTTCCATGCTGCCCAGCAGAGG + Intergenic
990827873 5:59922444-59922466 CCTTCCCTCCACCTAAGGAGAGG + Intronic
992153941 5:73935857-73935879 CATTCCATCCTCCCCATCAAAGG - Intronic
993170969 5:84418732-84418754 CCTTCCCCCCTCCCCATGACAGG + Intergenic
993888845 5:93448042-93448064 CCTTCCCTCCACCCCACGACAGG - Intergenic
996123092 5:119692975-119692997 ATTTCCATCTTCCCCATGAGAGG - Intergenic
997002984 5:129784476-129784498 CCTTCCTTCCACTCGAGGAGAGG + Intergenic
997647408 5:135490487-135490509 CCTTCTAACCTCGCCAGTAGAGG + Intergenic
998350148 5:141495083-141495105 CCTTCCCTCCTCGCCACGACCGG + Intronic
999084073 5:148871587-148871609 CTGTCCATGCTCCCCAGAAGAGG - Intergenic
999231574 5:150065148-150065170 CCTCCCATCCTCCCCACCAAAGG + Intronic
999850810 5:155536509-155536531 CCTTCCCTCCTCTCTGGGAGTGG + Intergenic
1000710447 5:164568751-164568773 CATTCCATACTCCCAAGAAGTGG + Intergenic
1001780383 5:174363775-174363797 CTTTCCATCCTTTGCAGGAGAGG + Intergenic
1001933880 5:175691249-175691271 CCTGACTTCCTCTCCAGGAGTGG - Intergenic
1002466606 5:179411884-179411906 CCTTCCACCCTCCCCACCACCGG + Intergenic
1003390273 6:5707644-5707666 CTTTTCTGCCTCCCCAGGAGGGG + Intronic
1004426947 6:15513177-15513199 CCTGCCATGCTCACCAGCAGAGG - Intronic
1005828611 6:29652301-29652323 CCTCCCAGCCTCCCCAGGACTGG + Intergenic
1006011350 6:31045340-31045362 CCTTCCCTCATTCCCTGGAGGGG - Intergenic
1006880182 6:37332311-37332333 CCTAGCAGCCTCCCCAGGAAGGG + Exonic
1007647886 6:43396815-43396837 CCTTCCATCCTCAGTATGAGTGG - Intergenic
1008333773 6:50275085-50275107 CCTTCCCTCCACCCCATGACAGG + Intergenic
1010711685 6:79182215-79182237 CTTTTCAACCTCCGCAGGAGGGG - Intergenic
1012753913 6:103199502-103199524 CCTTTCAACTTCCCCAGGTGTGG - Intergenic
1013086626 6:106863114-106863136 CCTTTCAGCCTCACCTGGAGTGG - Intergenic
1013171544 6:107640789-107640811 CCTTCCATCTTCAGCAGGACTGG + Intronic
1013542175 6:111121929-111121951 CCTTCCCACCTCCCCAGGATGGG + Intronic
1019076779 6:169394303-169394325 CCTTCCAGCAACACCAGGAGTGG + Intergenic
1019716456 7:2541597-2541619 CCTTGCATCCACGCCAGCAGTGG - Intronic
1019732177 7:2634406-2634428 CCTTCCTGCCTCCCCTGGTGAGG + Intronic
1019913813 7:4117856-4117878 CTTTCCCTCCTTCCTAGGAGAGG + Intronic
1022092971 7:27119703-27119725 CCTTCACTCCTCCCCTGCAGAGG + Intronic
1022950188 7:35331192-35331214 CCCTCCTTCCACCCCACGAGAGG + Intergenic
1023020221 7:36005239-36005261 CCTTACATCCTCCCTATGATAGG - Intergenic
1024082454 7:45866293-45866315 CCTTGCATCCCACCCAGCAGGGG - Intergenic
1024095027 7:45976379-45976401 CCTGCCATCCTCACCAGGGCTGG + Intergenic
1026628735 7:72019259-72019281 CCTTCCATTTTCCCCAGGCTTGG - Intronic
1027437563 7:78180701-78180723 TCTTCCATTCTTCCCAGCAGGGG + Intronic
1028181428 7:87729817-87729839 CCTTCCCTCCACCTAAGGAGAGG + Intronic
1028284663 7:88981404-88981426 CCTTCCTTCCACCTGAGGAGAGG - Intronic
1028988848 7:97028124-97028146 CCTTCCAGTCACCCCAGGTGGGG - Intergenic
1029625477 7:101718101-101718123 CCTTCCCTCCTGCCCGGCAGAGG + Intergenic
1030324267 7:108203367-108203389 CCTTCCCCCATCCCCAGGACTGG - Intronic
1031260016 7:119506864-119506886 CCTTCCCTCCTCCTAAGGAGAGG + Intergenic
1031545196 7:123043992-123044014 CCTTCCTTCCTTCCCAGAATGGG + Intergenic
1033868235 7:145718446-145718468 CCATCCCTCCTCACCAGGTGGGG - Intergenic
1034137810 7:148787636-148787658 GCTTCCATCCTACCCAGGCCTGG + Intronic
1035084591 7:156247319-156247341 CCTTCCCTCCCCCTAAGGAGAGG - Intergenic
1035618736 8:1022251-1022273 CCACCCATCCTCCCTGGGAGTGG + Intergenic
1035618795 8:1022471-1022493 CCATCCATCCTCCCTGGGATTGG + Intergenic
1035618810 8:1022526-1022548 CCACCCATCCTCCCTGGGAGTGG + Intergenic
1035618824 8:1022581-1022603 CCACCCATCCTCCCTGGGAGTGG + Intergenic
1035618882 8:1022801-1022823 CCACCCATCCCCCCCGGGAGTGG + Intergenic
1035653307 8:1285463-1285485 CCTTCCATCATCTCCAGGACAGG - Intergenic
1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG + Intergenic
1036714650 8:11109551-11109573 CATCTCATCCTCCCCAGGAAAGG + Intronic
1037526222 8:19727085-19727107 CCTTCCCTCAGCCCCAGGAATGG - Intronic
1039427167 8:37495472-37495494 CCCTTCATCCTGCCCTGGAGTGG + Intergenic
1039455286 8:37701879-37701901 CCTTCCTTCCTCCCAACAAGAGG - Intergenic
1040418662 8:47219194-47219216 CCTTCCAGCTGCCTCAGGAGTGG + Intergenic
1041428347 8:57749068-57749090 CCCTCCGTCCTCCCCAGGGCCGG + Intergenic
1041908878 8:63066711-63066733 CCTTCCCACCACCCCAGGACAGG + Intronic
1047028451 8:120850244-120850266 GATTACACCCTCCCCAGGAGAGG + Intergenic
1049350035 8:142159519-142159541 AATTCCATCCTTCCCAAGAGAGG - Intergenic
1049405711 8:142451054-142451076 GCTCCCAGCCTCCCCAGGAGGGG - Intronic
1049442606 8:142616147-142616169 CCTTCCTTCCGCCCCTGGGGGGG + Intergenic
1049494958 8:142925619-142925641 CCTTCCCACCTCCCCAGCACAGG - Intergenic
1049598061 8:143493474-143493496 CCTTCCACCTTCTCCAGGTGTGG - Intronic
1050480752 9:6084830-6084852 GCATCCATCCTCCTCAGGAAGGG + Intergenic
1050753353 9:8967901-8967923 CCCTCCCTCCACCCCACGAGAGG + Intronic
1050951018 9:11593538-11593560 CCTTCCAAACTCCCAAAGAGAGG + Intergenic
1051161464 9:14213386-14213408 CCATCCATTCTCCACAGCAGTGG + Intronic
1051229961 9:14945664-14945686 CCTTCCTTCCACTCGAGGAGAGG + Intergenic
1052070992 9:24081171-24081193 CCTTCCACCTTCCCTAGCAGAGG - Intergenic
1052852761 9:33387807-33387829 CCTTCCATCCTCCCACTGATCGG + Intronic
1053120098 9:35539821-35539843 CCTTTGATCCTACCCAGGAGAGG + Intronic
1053680861 9:40484348-40484370 CCTTCCATCCTCCCATTGATCGG + Intergenic
1053930849 9:43112662-43112684 CCTTCCATCCTCCCATTGATCGG + Intergenic
1054282852 9:63140587-63140609 CCTTCCATCCTCCCATTGATCGG - Intergenic
1054293943 9:63319863-63319885 CCTTCCATCCTCCCATTGATCGG + Intergenic
1054391968 9:64624352-64624374 CCTTCCATCCTCCCATTGATCGG + Intergenic
1054503761 9:65891976-65891998 CCTTCCATCCTCCCATTGATCGG - Intronic
1054743926 9:68835297-68835319 TCTTCCTTCCTCACCAGCAGTGG + Intronic
1054822502 9:69537541-69537563 CCTTCCCTCCTTTCCAGAAGAGG - Intronic
1055073920 9:72194517-72194539 CCTTCCTTCCACTCGAGGAGAGG - Intronic
1056846427 9:90041607-90041629 TTTTCAATCCTCCCCAGGATTGG + Intergenic
1057389310 9:94629638-94629660 CCCCCCTACCTCCCCAGGAGTGG - Intronic
1059339244 9:113588118-113588140 GCTTCCTTCCTCCCCTGCAGGGG + Intronic
1059459355 9:114420064-114420086 TCATCCTTCCTCCCCAGGAGCGG - Intronic
1059475868 9:114547156-114547178 CTTTCCTGCCTCCCCAGGATAGG - Intergenic
1059915297 9:119093177-119093199 CCTTGTTTCCTCCCCAGGAAAGG + Intergenic
1060394546 9:123306283-123306305 CATTCCATCCTTGCCAGGAGCGG + Intergenic
1060403456 9:123361400-123361422 CCTTCCAGCTCCCCCAGGAAAGG - Intronic
1060748115 9:126151038-126151060 CACTCCCACCTCCCCAGGAGAGG - Intergenic
1060867214 9:127010020-127010042 GCTTCCATTTTCCCCAAGAGAGG + Intronic
1060965899 9:127712148-127712170 CCTTCCCCCTTCCCCAGGACTGG - Intronic
1061064509 9:128268999-128269021 CCTTCCCTTCTCCCCTGCAGTGG + Intronic
1061290355 9:129647295-129647317 CCTGCCTTCAACCCCAGGAGGGG - Intergenic
1062070231 9:134551433-134551455 CCTGGCATCCTCCGCAGGTGAGG + Intergenic
1062325645 9:136011219-136011241 CCTCCCACCCTCCCCAAGAAGGG + Exonic
1186422318 X:9436073-9436095 CATTCCATCCACGCCAGGCGCGG + Intergenic
1186567248 X:10676716-10676738 CCCTCCTAGCTCCCCAGGAGAGG - Intronic
1188472300 X:30554425-30554447 TCTTCAATCCTCCCCAGGGTTGG + Intergenic
1190300410 X:49053890-49053912 CCTCCCTTCCTCCGCAGGCGGGG - Intronic
1190537824 X:51447021-51447043 CCTTCCTTCCACCTGAGGAGAGG - Intergenic
1190681392 X:52829963-52829985 CCCTCCTTCCTCCCCAGTTGTGG + Intergenic
1192025913 X:67451253-67451275 CCCTCCAGCCTCCCCAGCACAGG - Intergenic
1192841127 X:74857253-74857275 CCTTCCTTCCTCTTCAGGAGAGG + Intronic
1193999905 X:88415174-88415196 TCTGCCATCCTCCCCAGGCATGG + Intergenic
1194990606 X:100543226-100543248 CCTTCCCTCCACCTGAGGAGAGG + Intergenic
1197508997 X:127347126-127347148 CCTTCCCTCACCCCCAGTAGTGG - Intergenic
1198214936 X:134546619-134546641 CCTTCTACCTTCCCCACGAGGGG + Intergenic
1198375990 X:136040829-136040851 CCTTCCATTCTGGCCAGGCGTGG + Intronic
1198489854 X:137128380-137128402 CCTTCCATCCACCCCACAACAGG - Intergenic
1198886253 X:141341826-141341848 CCTTCCCTCTTCCCAAGGAAAGG + Intergenic
1198956379 X:142136152-142136174 CCTTCCTTCCTCCTGAGGAGAGG + Intergenic
1199372298 X:147064555-147064577 CCTTCCATCCCACCCAGGAACGG - Intergenic
1200149080 X:153942726-153942748 CCCTCCACCTTCCCCAGGTGGGG + Intronic
1200267311 X:154653291-154653313 CCTTCCATCCTGCGCAGAAGCGG + Exonic