ID: 1085510609

View in Genome Browser
Species Human (GRCh38)
Location 11:77086312-77086334
Sequence CCCCGTAGATGTCCTTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 45}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085510603_1085510609 15 Left 1085510603 11:77086274-77086296 CCCAGGCTATGATCTCGAGTCCC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 45
1085510604_1085510609 14 Left 1085510604 11:77086275-77086297 CCAGGCTATGATCTCGAGTCCCT 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 45
1085510601_1085510609 19 Left 1085510601 11:77086270-77086292 CCCTCCCAGGCTATGATCTCGAG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 45
1085510605_1085510609 -5 Left 1085510605 11:77086294-77086316 CCCTTCTGACTGAAAATACCCCG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 45
1085510606_1085510609 -6 Left 1085510606 11:77086295-77086317 CCTTCTGACTGAAAATACCCCGT 0: 1
1: 0
2: 0
3: 0
4: 90
Right 1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 45
1085510602_1085510609 18 Left 1085510602 11:77086271-77086293 CCTCCCAGGCTATGATCTCGAGT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085510609 Original CRISPR CCCCGTAGATGTCCTTGGAC TGG Intronic
900528698 1:3142135-3142157 CCCCGGAAATGGCCCTGGACGGG - Intronic
905031138 1:34885330-34885352 CCCCGTCGATGTCCAGGCACGGG + Intronic
910729704 1:90381121-90381143 TCCCCTAGATGACCTTGGACAGG - Intergenic
916415972 1:164592268-164592290 CCCAGTATATGTCCTAGGAAAGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
922724517 1:227916159-227916181 CCTGGTGGATGTCGTTGGACAGG + Intergenic
923679814 1:236110454-236110476 CCTGGTTGATGTCCTTGGCCTGG - Intergenic
1064004370 10:11688383-11688405 ACCCCCAGATCTCCTTGGACAGG - Intergenic
1068885365 10:62092031-62092053 CCCTGTACATGTCCCTGGAAGGG - Exonic
1069750785 10:70743939-70743961 CCTGGGAGATGTCCCTGGACAGG - Intronic
1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG + Intronic
1090356790 11:126146057-126146079 CCCCGTAGCTGTCCTCGGCAGGG + Intergenic
1090802785 11:130183809-130183831 TCCCGTAGCTGTCTTTGTACTGG - Intronic
1096578717 12:52570767-52570789 CCCGGTTGTTGTCCATGGACAGG + Exonic
1101499647 12:105290724-105290746 CTCTGTACATGTCCTTGAACTGG - Intronic
1117566808 14:57001754-57001776 CCTCGTTGATGTCCTTGGAAGGG - Intergenic
1122826266 14:104372327-104372349 CCCAGTAGATGACCTGTGACTGG - Intergenic
1127396893 15:58550325-58550347 CCCAGTAGATGTCCTAGGGCTGG - Intronic
1130546807 15:84862777-84862799 GCCCGTAGATGACCTTGGCCTGG - Exonic
1132990295 16:2788992-2789014 GCCCATAGTTGTCCTTTGACAGG + Intergenic
1145213525 17:21034307-21034329 TGCCGGTGATGTCCTTGGACAGG + Intronic
1145537203 17:24501139-24501161 CTCCGAAGATGTCTTTGGAAAGG + Intergenic
1145657787 17:26254431-26254453 CTCCGAAGATGTCTTTGGAAAGG + Intergenic
1145660767 17:26297865-26297887 CTCCGAAGATGTCTTTGGAAAGG + Intergenic
1146061193 17:29608191-29608213 CCACGTAGAAGTCCTGGGCCTGG - Exonic
1152599229 17:81253124-81253146 GCCCGTGGATGTGCCTGGACGGG - Exonic
1164513476 19:28915604-28915626 CCCCGTAAATGTCCAAGGAAAGG + Intergenic
1164545886 19:29162320-29162342 CCAGGTACATGTCCTTGAACTGG + Intergenic
1164833974 19:31345258-31345280 CCACGTATTTCTCCTTGGACAGG - Intronic
1165355697 19:35302572-35302594 TCTCGTAGATGACCGTGGACAGG - Exonic
946082612 2:217136075-217136097 TCTCATAGATGTCCTTGGTCAGG + Intergenic
1172583937 20:36069333-36069355 CCCTGTTGATAACCTTGGACTGG - Intergenic
1179626856 21:42653838-42653860 CCAGGTAGATGGCCTTGGGCCGG - Exonic
1184877644 22:47285631-47285653 CCTCGCAGATGGCCTTGGAGTGG + Intergenic
950670817 3:14524374-14524396 CCCGGTGGGTGCCCTTGGACGGG - Exonic
953173486 3:40528444-40528466 CCCTGTAAATGTCCATGTACAGG + Intronic
968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG + Intergenic
969573876 4:8025357-8025379 CCCGGGAGATGCCCTTGGAGGGG + Intronic
971335790 4:25722965-25722987 CCACGTAACTCTCCTTGGACTGG - Intergenic
978881275 4:113705701-113705723 CTCCATAGATCTCCTTAGACTGG + Intronic
980033480 4:127857035-127857057 CCACGGAGATGTCCTTGTAAGGG + Intergenic
985229383 4:187798816-187798838 TCCCGGACAGGTCCTTGGACAGG + Intergenic
999124910 5:149239749-149239771 TCTCGTAGATGTCCTGGGAGAGG - Exonic
1001590231 5:172859728-172859750 CTCCGCAGGTGCCCTTGGACAGG + Intronic
1002200239 5:177524000-177524022 CCCCGTCCATGTCCTTGGGCAGG + Exonic
1006804875 6:36781635-36781657 CCCCATCCATGTCCTGGGACAGG + Intronic
1031484011 7:122307046-122307068 CTTCGTAGTTGTCCTTGGACCGG + Intronic
1035292677 7:157849669-157849691 TCCCGTAAATGTCCCTGGCCAGG - Intronic
1060101463 9:120843985-120844007 CCCTGTAGATGTATTTGGCCTGG - Intergenic
1062002535 9:134223951-134223973 CCCCGGACATGGCCTTGGCCTGG + Intergenic
1194546496 X:95240644-95240666 CCACCTTGATGTTCTTGGACAGG - Intergenic
1197309664 X:124888902-124888924 CCTGCTATATGTCCTTGGACAGG - Intronic