ID: 1085512060

View in Genome Browser
Species Human (GRCh38)
Location 11:77093448-77093470
Sequence CTCTGGCCAGGAAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 0, 2: 6, 3: 78, 4: 634}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085512051_1085512060 18 Left 1085512051 11:77093407-77093429 CCACAGGTTCTTCATCAGCAAAC 0: 1
1: 0
2: 16
3: 248
4: 1898
Right 1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 78
4: 634
1085512053_1085512060 -4 Left 1085512053 11:77093429-77093451 CCTTTAGCGGAAGAGCACTCTCT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 78
4: 634
1085512050_1085512060 19 Left 1085512050 11:77093406-77093428 CCCACAGGTTCTTCATCAGCAAA 0: 1
1: 0
2: 2
3: 34
4: 315
Right 1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 78
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085512060 Original CRISPR CTCTGGCCAGGAAGGGGAGA GGG Intronic
900214703 1:1475286-1475308 GTGAGGCCAGGAAGGAGAGAAGG - Intronic
900386526 1:2413301-2413323 CTCAGGCCAGGCAGGGTGGAGGG - Intronic
900473371 1:2865113-2865135 CTCTGGCCTGGCAGGGTTGAGGG + Intergenic
900765852 1:4504966-4504988 CTCGGGCCAGGCGGGGAAGATGG + Intergenic
900966837 1:5964656-5964678 CACTGGCCAGGGAGTGGAGAAGG - Intronic
901238587 1:7680325-7680347 CGCTGGCCAGGCCGTGGAGACGG + Intronic
901344708 1:8529757-8529779 CTCTGACCAGGAGGAGGAGGAGG - Intronic
901756538 1:11444757-11444779 CTCTGCCCAGGCAGGTGGGATGG - Intergenic
902281947 1:15381308-15381330 CTCCCGCCAGGAGAGGGAGAAGG + Exonic
902319824 1:15653607-15653629 AGCTAGTCAGGAAGGGGAGATGG - Intronic
902542948 1:17167214-17167236 CTGTGGCCAGGAAGGGAGGGAGG - Intergenic
903904550 1:26674643-26674665 CTGTGTCCAGGAGGCGGAGATGG + Intergenic
904289949 1:29478507-29478529 CTCTGCCCATCAAGGGGAGCCGG + Intergenic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905292508 1:36932043-36932065 GTTTATCCAGGAAGGGGAGAGGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905645311 1:39621258-39621280 CTCTCTCCAGGAAGGAGGGAAGG + Intergenic
906205780 1:43985634-43985656 CTCTGGGGAGTAAGGGGTGAGGG - Intronic
906640086 1:47436686-47436708 CTGGGGCACGGAAGGGGAGATGG - Exonic
906669620 1:47645102-47645124 CACTGGCCATGAGGGAGAGAAGG + Intergenic
907312751 1:53548390-53548412 CTCGGGGCAGGAACGAGAGAAGG + Intronic
907344010 1:53759182-53759204 CTCTGCTCAGGAAGTGCAGAAGG - Intergenic
908096571 1:60745686-60745708 CTCTGGCTAGGAAGGGAAACAGG + Intergenic
910149621 1:84126331-84126353 CTCTTGGCAGGATGGGGAGCTGG + Intronic
910486295 1:87718121-87718143 TACTGGCAAGGAAGGGAAGATGG + Intergenic
910520637 1:88118223-88118245 CTCTTGACAGGAAGGAGAAATGG - Intergenic
911155328 1:94630551-94630573 TTCTTGCCAGGAAGTGGGGAAGG - Intergenic
912233287 1:107820453-107820475 CTGAGGCTAGGAAGGGGAGTGGG + Intronic
912569389 1:110610348-110610370 GTCATGCCAGGAAGGGGAGCTGG - Intronic
913356636 1:117929616-117929638 CTCTGGCCAGGAGCGGAAGCCGG - Exonic
913957649 1:143319396-143319418 GTCAGGCCAGGAAGGGGCCAGGG - Intergenic
914051959 1:144144760-144144782 GTCAGGCCAGGAAGGGGCCAGGG - Intergenic
914127238 1:144821781-144821803 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
914745139 1:150496066-150496088 ATGTGGCCAGGAATGGGATATGG + Intronic
915320447 1:155053187-155053209 CTCTGGGCAGGAAGCCGAGAAGG + Intronic
915931234 1:160062152-160062174 CTCTGGGCAGGCTGGGGAGATGG - Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916461483 1:165029257-165029279 CTACTTCCAGGAAGGGGAGAGGG + Intergenic
917804200 1:178598606-178598628 ACCTGGCCAGGAAGAGGACAGGG - Intergenic
918262187 1:182806308-182806330 CTCTGACCAGGAAGCAGGGAGGG - Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918838368 1:189500358-189500380 CTCTGGCCAAAAAGGTGAAAAGG + Intergenic
919726614 1:200888605-200888627 CTCTGGCCAGGCAGAGGAAGAGG - Intergenic
920212322 1:204337155-204337177 CAATGGCCAGGCAGGGGAGTTGG + Intronic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
920569093 1:207002817-207002839 CTTTGGGCAGGAAGGGGTGGAGG + Intergenic
920702739 1:208230327-208230349 CTCAGGTCAGCACGGGGAGAAGG - Intronic
922218205 1:223538133-223538155 CTGTGTCCTGGAAGGGTAGAAGG + Intronic
922616577 1:226964586-226964608 CTAAGGCCAGCAAGGGGTGAGGG - Intronic
922911551 1:229221937-229221959 TTCTGGAAAGGAAGGGGAGAAGG + Intergenic
923438399 1:233992125-233992147 CTCTGGACAAGAATGTGAGAGGG + Intronic
924809560 1:247389175-247389197 TTGTGACCAGGAAGGGAAGAAGG - Intergenic
1062804495 10:407164-407186 CTCTGGCCAGGCAGCGGGCAAGG + Intronic
1063060461 10:2545771-2545793 CACTGGCCAGAAAGGGGAGGAGG + Intergenic
1063383312 10:5600397-5600419 CTCTGGCCAGGAGGCGGGAAGGG - Intergenic
1063971499 10:11384350-11384372 CTGTGGCAAGGCAGTGGAGAAGG + Intergenic
1064091729 10:12391125-12391147 TTTTGGCCATGAAGGGTAGAGGG + Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1065310980 10:24415796-24415818 CTCTGGCCAGGGCTGAGAGAAGG + Intronic
1066210792 10:33235988-33236010 CTCTTTGCAGGAAGGGGAGGAGG - Intronic
1066275206 10:33861995-33862017 CTCTGGCCAGTAAAGGAAGGGGG + Intergenic
1066745955 10:38604348-38604370 CCCTGGCCAGGAGAGGGACAGGG - Intergenic
1067061848 10:43081728-43081750 CTTGGGGCTGGAAGGGGAGAAGG + Intronic
1067559977 10:47298440-47298462 TTCTGGGGGGGAAGGGGAGAGGG + Intergenic
1068271468 10:54731785-54731807 CAGTGGCCAGGAAAGGTAGATGG + Intronic
1068585976 10:58799154-58799176 GTCAAGCCAGGAGGGGGAGATGG - Exonic
1069170778 10:65226120-65226142 TTCTGGCCATGATGGGGAGTGGG + Intergenic
1069709707 10:70480466-70480488 CACTGGCCAGGAAAGGGAGGGGG - Intronic
1070168771 10:73916762-73916784 CTCTGGCCAGGATGGAGGGGTGG + Exonic
1070280855 10:75047177-75047199 CCCTGGACGGGAAGGGGAGTTGG + Intronic
1070362373 10:75703247-75703269 CTTTTCCCAGGAAGGGAAGAAGG + Intronic
1070669260 10:78366651-78366673 CACTGGCAGGGATGGGGAGAGGG + Intergenic
1071531667 10:86394346-86394368 CTCTGCCCTGGAAGGGGAACAGG - Intergenic
1071574995 10:86718685-86718707 CTCAGGACAGAAAGGAGAGAGGG - Intronic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072841615 10:98780860-98780882 GTCTGCCCAGGAAGAGGAAATGG - Intronic
1072987184 10:100151254-100151276 CTCTGGCCAAGAGTGGGACAGGG - Exonic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073067089 10:100767998-100768020 CTATGGCCAGGATGGGGTGGGGG - Intronic
1073150216 10:101306224-101306246 CTCTGGCCAATGAGGGGAGTTGG + Intergenic
1073289917 10:102408524-102408546 CTCTGGCCAGAAAGCGGAAGTGG + Intronic
1073347497 10:102794891-102794913 CTCTAGCAAGGAAGAGGTGAAGG - Intronic
1073442232 10:103559021-103559043 CTGTGGCCAGGAAAGGGAAATGG + Intronic
1073793223 10:106960808-106960830 TTCTGTGCAGGAATGGGAGAGGG + Intronic
1074445711 10:113519725-113519747 CTCCGGCCAGGAGGCTGAGAGGG - Intergenic
1074481604 10:113826866-113826888 CTCAGGCTAGAAAGGGTAGATGG - Intergenic
1075122952 10:119677594-119677616 CTCTGGACTGGAGGGGTAGATGG + Exonic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1077154107 11:1083870-1083892 CCATGGCCTGGAAGGGCAGACGG + Intergenic
1077300505 11:1844389-1844411 CTGTGGCCAGGAAGGGGTTGGGG + Intergenic
1077374520 11:2199300-2199322 TTCTGGGCAGGAGGGTGAGAAGG - Intergenic
1077523401 11:3049685-3049707 CTGTGCCCAGGAAGGGCAGCTGG - Intronic
1077548692 11:3189387-3189409 CTCTGGCCAGGGAGGCGGGTGGG + Intergenic
1077918271 11:6625019-6625041 CTGTACCCAGAAAGGGGAGAAGG - Intronic
1079366474 11:19814379-19814401 CCCTGGCCAGGGGAGGGAGAGGG - Intronic
1080384047 11:31800019-31800041 CTCTGGTCTGGGAGGAGAGATGG - Intronic
1080538186 11:33242943-33242965 CACAGGCTAGGAAGGGGAGTGGG + Intergenic
1081533875 11:43983502-43983524 CTCTGTGCTGTAAGGGGAGATGG + Intergenic
1082092339 11:48100151-48100173 CTCTGGCCATGATGGACAGAAGG + Intronic
1082272325 11:50184726-50184748 CTCTGGAAAGGAAGGGGAAGGGG - Intergenic
1083058884 11:59848948-59848970 CACTGGCCAGGGAATGGAGAAGG - Intergenic
1083418889 11:62542650-62542672 TCCTGGCCAGGGAGGGAAGAGGG - Intronic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1084069869 11:66727543-66727565 CTGTGGCCAGGAAGCTGATAGGG - Intronic
1084215620 11:67645501-67645523 CTCTGGCAGGGTAGGGGAGGGGG + Intronic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1084466822 11:69328177-69328199 CACTGGGCAGGATGGGGACAGGG - Intronic
1084961060 11:72716970-72716992 CTCAGGTCATGTAGGGGAGACGG - Intronic
1085193173 11:74646954-74646976 CCATGGCCAGATAGGGGAGATGG + Intronic
1085447622 11:76611095-76611117 CTCCGGCCATGGAGAGGAGAGGG + Intergenic
1085475145 11:76784356-76784378 CTCGGACCCGGTAGGGGAGAGGG + Intronic
1085501614 11:77029887-77029909 TGATGACCAGGAAGGGGAGAAGG - Intergenic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1086199147 11:84179631-84179653 CTCTGGCAGGGAAGAGGAAAAGG + Intronic
1088235588 11:107719392-107719414 GCCTGGCCTGGTAGGGGAGAGGG + Intronic
1089183513 11:116598951-116598973 CTCTCAGCAGGAAGAGGAGACGG + Intergenic
1089213139 11:116819782-116819804 CTGTGGCGAGGAAAGGGAGGTGG + Intergenic
1089278589 11:117356478-117356500 CTCTTGCCAAGCAGGGGCGAGGG - Intronic
1089411995 11:118252095-118252117 CTCTGGGAAGGAAGGAGGGAGGG - Intronic
1090238272 11:125165117-125165139 CGCTGGCCGGGCAGGGGAGCGGG - Intronic
1091540172 12:1453302-1453324 CTGTTGCCAGGAAGGAGACAGGG - Intronic
1091594263 12:1865123-1865145 ACCTGGCCACGGAGGGGAGAAGG + Intronic
1091777052 12:3191408-3191430 CACTGGACAGGCAGGGGGGAAGG - Intronic
1091932505 12:4407482-4407504 TGCTGACCAGGCAGGGGAGAAGG - Intergenic
1092680073 12:10969099-10969121 CTCTCAGCAGGAAGGGGAGCTGG + Intronic
1093261978 12:16950166-16950188 CTCTGCCCAAGAGGGGCAGAGGG + Intergenic
1094118337 12:26941302-26941324 TTTTGGCCAGGAAGTGGAGTGGG - Intronic
1095980270 12:47969071-47969093 CTCTGTCCTGGAAGGGAACAGGG - Intergenic
1096491113 12:52013602-52013624 CCTTAGCCAGAAAGGGGAGAAGG - Intronic
1096514764 12:52149724-52149746 CTCTGGCCAGGACAGGGGGCAGG - Intergenic
1096538200 12:52288587-52288609 CTCATCCCAGGAAGGGCAGAAGG - Intronic
1096545818 12:52339528-52339550 CTGTGGCCAGCAAGTGGTGAGGG + Intergenic
1096670984 12:53198081-53198103 CTGTGGCGAGGAAGAGGGGAGGG - Intronic
1097185787 12:57195612-57195634 CGCTGGCCAGGCAGGGCTGAAGG + Intronic
1097340632 12:58433927-58433949 CTCTGTCTAGGAAGTGGACAAGG - Intergenic
1097737136 12:63194772-63194794 AAGTGGCCAGGGAGGGGAGATGG - Intergenic
1098341310 12:69454341-69454363 CAGAGGCCAGGAAGGGTAGAGGG - Intergenic
1098457837 12:70695586-70695608 ATCTGGGCAGGAAATGGAGAAGG + Intronic
1098700899 12:73624365-73624387 CTCAGTCCAGTGAGGGGAGATGG + Intergenic
1098886977 12:75970134-75970156 CTGTGGTCTGGAAGGAGAGAAGG - Intergenic
1100695135 12:97084499-97084521 CTCTGAACTGGAAAGGGAGAGGG + Intergenic
1100804950 12:98273230-98273252 CACAGGCCAGGAAGGGCAGTGGG + Intergenic
1100904023 12:99277023-99277045 CTCATGACAGGTAGGGGAGAAGG - Intronic
1101102367 12:101407314-101407336 CTCTGCCCAGCAAGTGGAGCTGG + Intronic
1101870242 12:108559977-108559999 CTTTGGGCCGGAAGGGGTGAAGG - Intronic
1102030629 12:109738199-109738221 TTCTGGCCAGGAAGAGTGGAGGG - Intronic
1102228712 12:111247674-111247696 CTGGGGGCAGGATGGGGAGAGGG + Intronic
1102657204 12:114492050-114492072 CTTTGGAGAGGAAGGGGAGTGGG + Intergenic
1102908266 12:116694017-116694039 CTCTGGAACGGAAGAGGAGAGGG + Intergenic
1102924528 12:116816453-116816475 TTCTGGCGAGGAGGGGGAGGAGG - Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104836733 12:131796457-131796479 CTCTGGGAAGCAAGGGGACAGGG + Intronic
1105280302 13:18959332-18959354 CTCTGACCAGGAAGAAGGGATGG - Intergenic
1106014595 13:25856747-25856769 GGCTGGGGAGGAAGGGGAGAAGG - Intronic
1106076282 13:26464065-26464087 CTCTGGCCAGGGCTGGAAGAGGG + Intergenic
1106588185 13:31075198-31075220 ATGTGTCCAGGAAGGGGAAAGGG - Intergenic
1108241941 13:48474232-48474254 CTCTATCCAGGGAGGGGAGGGGG - Intronic
1108420150 13:50240415-50240437 CTCTGGCCTGGAGGGAGAGAGGG - Intronic
1108573508 13:51771910-51771932 CTCTGGACAGGAAGGAGCGAGGG + Exonic
1108582453 13:51838805-51838827 CACAGGCCTGGAGGGGGAGATGG + Intergenic
1109047003 13:57425661-57425683 CTCTGGACAGGAATGGGAGATGG - Intergenic
1109173490 13:59125661-59125683 CTATTCCCAGGAAGGGGAGAAGG + Intergenic
1109805090 13:67429263-67429285 TTCAGGCCATGAAGGGAAGAGGG + Intergenic
1109991735 13:70067572-70067594 CTTTGGCCAGGAAGGATAAAAGG + Intronic
1110950771 13:81487601-81487623 CATTGTCCATGAAGGGGAGAAGG - Intergenic
1111235816 13:85406178-85406200 CTCTCAGCAGGAAGGGGAGCTGG + Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112896299 13:104304301-104304323 CACTGGCATGGAAGGGGTGAGGG + Intergenic
1113419945 13:110163481-110163503 CCCTGGCCAGAAAGGAGAGATGG - Exonic
1113445326 13:110361837-110361859 CTCTGCCCAGGGAGGGGAAGTGG - Intronic
1113774958 13:112938813-112938835 CTGTGGCCAGGCAGGAGAGCTGG + Intronic
1114173267 14:20295774-20295796 CTCTGGCCAGGCAGGGTCCAGGG + Exonic
1114307115 14:21433756-21433778 GGCTAGCCAGGAATGGGAGATGG - Intronic
1114466861 14:22929245-22929267 CTGTGGCCAAGCAGGGGTGAGGG - Exonic
1114494278 14:23121734-23121756 CTCTGGACAGGAATGGGAGGTGG + Intergenic
1114674360 14:24430698-24430720 CCCAGCCCTGGAAGGGGAGAAGG - Exonic
1116004045 14:39273431-39273453 CTGTGCCCAGGAAGTCGAGACGG - Intronic
1117377456 14:55129330-55129352 CTCCGGCCGGGCAGGGGAGAGGG + Intronic
1117735997 14:58769261-58769283 CTGTGGCCTGGAAGGGGGTAAGG - Intergenic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118770365 14:68938885-68938907 CTCTGGCCAAGAGGAGGAGATGG + Intronic
1119423544 14:74522146-74522168 GTGTGGCAAGGAAGGGGTGAGGG + Intronic
1119443942 14:74648167-74648189 TCCAGGCCAGGAAGGAGAGAAGG - Intergenic
1119615492 14:76096195-76096217 CTCTGGCCAGGCAGAGGAAAGGG - Intergenic
1119970374 14:78963469-78963491 CTCCTACCAGGAAGGGGAGCTGG - Intronic
1120997095 14:90425323-90425345 CACTGGCCTGGAACGAGAGAAGG + Intergenic
1121145602 14:91579477-91579499 CTCTCGGCAGGAAGGGGAGTTGG - Intergenic
1121609572 14:95268003-95268025 CAGAGGCCAGGAAGGAGAGAGGG + Intronic
1121610250 14:95273752-95273774 CTCAGGCACGGAAGGGCAGAGGG - Intronic
1121933072 14:97990971-97990993 CACTGAACAGGAAGGGAAGATGG + Intergenic
1121979750 14:98444223-98444245 CTCTGGGCAGGAAGTGGGGGTGG + Intergenic
1122147448 14:99700121-99700143 CTCTGGCCAGGCAGGAGCCACGG - Intronic
1122346044 14:101061007-101061029 CTCTGGGAAGCAAGGGGTGAAGG + Intergenic
1122596836 14:102899582-102899604 AGCTGGCCAGGAAGGGAAGCAGG - Intronic
1122598516 14:102909380-102909402 CTCTGGGGAGGAAGGGGTGGTGG - Exonic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202930732 14_KI270725v1_random:30694-30716 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1123421624 15:20140718-20140740 GTCAGGCCAGGAAGGGGCCAGGG - Intergenic
1123443431 15:20305798-20305820 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1123530850 15:21147258-21147280 GTCAGGCCAGGAAGGGGCCAGGG - Intergenic
1124005523 15:25792762-25792784 CCCTGCCCTGGCAGGGGAGATGG - Intronic
1124551308 15:30683481-30683503 CTCTGGCAGGGACTGGGAGAGGG - Intronic
1124679939 15:31722184-31722206 CTCTGGCAGGGACTGGGAGAGGG + Intronic
1124713119 15:32031064-32031086 CGGAGCCCAGGAAGGGGAGAGGG - Intronic
1124993594 15:34700384-34700406 CAGAGGCCAGGAAGGGGAGAAGG - Intergenic
1125348372 15:38742400-38742422 GGCTGGTCAGGAATGGGAGAGGG - Intergenic
1125880446 15:43189478-43189500 GTCAGGCAAGGCAGGGGAGATGG - Intronic
1127335298 15:57978705-57978727 GTCAGGCCCAGAAGGGGAGAAGG + Intronic
1127646901 15:60967902-60967924 CTCTGTGGAGGCAGGGGAGATGG - Intronic
1127896048 15:63299848-63299870 CCCTGGCCAGAAAACGGAGAAGG + Intronic
1128094644 15:64944489-64944511 TTCTGGGCATGAAGGGGATATGG - Intronic
1128241741 15:66105988-66106010 CTCTGGCCAGGGGAGGGAGGAGG + Intronic
1128441892 15:67717780-67717802 AGCTAGCCATGAAGGGGAGATGG - Intronic
1128687380 15:69696802-69696824 GACTGCCCAGGAAGGGGAGCAGG + Intergenic
1129460552 15:75698208-75698230 GTCTGGGCAGGCAGGGGTGAGGG + Intronic
1129481746 15:75832015-75832037 CTCTTTCCAGGAAGGGCACAAGG + Intergenic
1129677962 15:77642612-77642634 CTAGGGCCAGGTTGGGGAGAGGG - Intronic
1129724309 15:77893828-77893850 GTCTGGGCAGGCAGGGGTGAGGG - Intergenic
1129737626 15:77974941-77974963 CTCTAGCCAGGCAGGGGAGATGG - Intergenic
1129848448 15:78778678-78778700 CTCTAGCCAGGCAGAGGAGATGG + Intronic
1129851483 15:78796424-78796446 CTGAGGCCAGGAAGGGGTGGGGG - Intronic
1129906484 15:79191169-79191191 CACTGGCCAGGTAGGGAGGACGG + Intergenic
1130253474 15:82315269-82315291 CTCTAGCCAGGCAGGGGAGATGG - Intergenic
1131098223 15:89669400-89669422 CTCAGGACAGGAAGGGGTGATGG + Intronic
1131220248 15:90577858-90577880 CAGAGGCCAGGAAAGGGAGAGGG + Intronic
1131466713 15:92661352-92661374 CACTGTCCGAGAAGGGGAGAGGG + Intronic
1131990479 15:98088601-98088623 CCCTGGGGAGGAATGGGAGAGGG - Intergenic
1132099665 15:99014696-99014718 CCCTGGGGAGGAATGGGAGAGGG + Intergenic
1132143435 15:99412915-99412937 CCATGACCAGGGAGGGGAGAGGG - Intergenic
1132871555 16:2117754-2117776 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1132871895 16:2119016-2119038 CTCAAGCCTGGAAGGGGACACGG + Intronic
1133000063 16:2845781-2845803 CTCAGGCCATGATGGGAAGAGGG + Intergenic
1134061504 16:11202240-11202262 CTGAGGCCAGGAAGGGGCCAGGG - Intergenic
1134064920 16:11221929-11221951 CTCTGGCCAGGAGGTGGGGAGGG + Intergenic
1134520632 16:14917880-14917902 CTCAAGCCTGGAAGGGGACACGG - Intronic
1134520974 16:14919141-14919163 CCCTGGGGAGGAAGGGGAGTGGG - Intronic
1134550598 16:15136832-15136854 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1134708304 16:16316531-16316553 CTCAAGCCTGGAAGGGGACACGG - Intergenic
1134708650 16:16317792-16317814 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134715519 16:16356564-16356586 CTCAAGCCTGGAAGGGGACACGG - Intergenic
1134715863 16:16357825-16357847 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134950954 16:18350853-18350875 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1134951298 16:18352114-18352136 CTCAAGCCTGGAAGGGGACACGG + Intergenic
1134958893 16:18394334-18394356 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1134959238 16:18395595-18395617 CTCAAGCCTGGAAGGGGACACGG + Intergenic
1135235864 16:20755167-20755189 CACTGCCCAGGTAGGGGACAGGG - Intronic
1136284592 16:29233570-29233592 CTCAGAGCAGGAAGGGCAGAGGG + Intergenic
1136576939 16:31130676-31130698 ATCTGGCCAGGATGGTGACAGGG - Intronic
1136863212 16:33714919-33714941 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1137055132 16:35742051-35742073 CTCTGCCCAGGAAGGAAAGAAGG + Intergenic
1137411867 16:48235584-48235606 GTCAGTCCAGGAAGTGGAGATGG - Intronic
1137679699 16:50329670-50329692 CTGTGGTCAGGAAGGGCAGCCGG + Intronic
1138632312 16:58307673-58307695 CTCAGGCCATGATGGGAAGAGGG + Intronic
1139692407 16:68649698-68649720 GTCAGGCCCAGAAGGGGAGATGG + Intronic
1139751526 16:69111878-69111900 AGATGGCCAGGAAAGGGAGATGG - Intronic
1140322855 16:73970535-73970557 TTCCGGCAAGGAAGGTGAGATGG + Intergenic
1140620788 16:76729671-76729693 CACTGGCCAGAAGGGGCAGAGGG + Intergenic
1142062315 16:88038370-88038392 CACAGGCCTGGAAGGGGGGAGGG + Intronic
1142089624 16:88203083-88203105 CTCAGAGCAGGAAGGGCAGAAGG + Intergenic
1203124704 16_KI270728v1_random:1563072-1563094 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1142979521 17:3663576-3663598 CCCAGGCCAGGGATGGGAGAAGG + Exonic
1143097761 17:4487611-4487633 CTCTCCCCTGGAAGGGGAGTCGG - Intronic
1143360330 17:6364155-6364177 CTCTGCTCCGGAAGGGGCGAGGG - Intergenic
1144213088 17:13031690-13031712 CAGTGGCCAGGAAGGTAAGATGG + Intergenic
1144482376 17:15638692-15638714 CCCTGGCAAGGAAGGAGAGAGGG + Intronic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144916307 17:18726340-18726362 CCCTGGCAAGGAAGGAGAGAGGG - Intronic
1145252216 17:21302853-21302875 CTCTGCCACGGGAGGGGAGATGG + Intronic
1145900648 17:28488498-28488520 CTCAGGCCTGGAAGGGGACCTGG - Intronic
1146280337 17:31540493-31540515 GGCTGGCCAGGTAAGGGAGATGG + Intergenic
1146287026 17:31581103-31581125 AGCTGGGCAGGAAGGAGAGAGGG - Intergenic
1146660323 17:34661312-34661334 CTAGTGGCAGGAAGGGGAGAGGG - Intergenic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147261577 17:39212219-39212241 TTCTGGCCAGGGAGGGGATCAGG - Exonic
1147634502 17:41955196-41955218 CACTGGAGAGCAAGGGGAGAAGG - Exonic
1147996170 17:44361600-44361622 CTCTGGCCTGGGAGGGGAGGTGG - Intronic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148211670 17:45812623-45812645 CCCTAGCTGGGAAGGGGAGAAGG - Intronic
1148232050 17:45942415-45942437 CTCCGGCCAGGCAGGGCAGATGG - Intronic
1148465575 17:47863123-47863145 CTCTGGGCAGGAAAGGAGGATGG + Intergenic
1148737044 17:49870824-49870846 GGCTGAGCAGGAAGGGGAGAGGG - Intergenic
1148739779 17:49886228-49886250 CTCTGCCCAGAGAGGGGAAAAGG + Intergenic
1148834267 17:50457368-50457390 CTCTGGCCAGGAGGGTGTGGAGG + Intronic
1149687090 17:58542223-58542245 CTCTGGCTACAAAGTGGAGAGGG - Intronic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150225397 17:63522073-63522095 TCCTGGAGAGGAAGGGGAGAAGG - Intergenic
1150317108 17:64178268-64178290 CTCTGGCCTGGAGGGGGTCAGGG + Intronic
1150788178 17:68179658-68179680 CTCTCACCAGGAGGCGGAGATGG - Intergenic
1150836007 17:68564883-68564905 CTCCAGACAGGGAGGGGAGACGG + Intronic
1151407645 17:73899825-73899847 TACTGGCCAGAGAGGGGAGAGGG - Intergenic
1151561464 17:74872134-74872156 CTGGGGCCAGGCAGAGGAGAGGG + Intronic
1152123162 17:78431350-78431372 GTGGGGCCAGGAGGGGGAGAGGG - Intronic
1152531603 17:80922378-80922400 CTCTGGCAGGGAAGGTGAGGAGG + Intronic
1152621251 17:81366022-81366044 CTGTGGCCATGAAGGCGGGAGGG - Intergenic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153014818 18:573968-573990 ATCTGGGAAAGAAGGGGAGAGGG + Intergenic
1154154724 18:11934953-11934975 CTCTGTCTAGGAAGGAGGGAAGG + Intergenic
1154437306 18:14356975-14356997 GTCAGGCCCGGAAGGGGAGAAGG + Intergenic
1155067463 18:22280081-22280103 CTCTGGCCCTGAAGGGGACAGGG + Intergenic
1155083029 18:22429440-22429462 CCCTGTCCAGGAAGGGTGGAGGG - Intergenic
1155566917 18:27145512-27145534 CTCTGACCTGGAAGGGGCCAGGG + Intronic
1156295367 18:35784527-35784549 CTCTTGGCAGGAAGGGGAAAGGG + Intergenic
1156370393 18:36467472-36467494 CTCTGCCCTGGAAGGGAAGAAGG - Intronic
1157168427 18:45379955-45379977 CTCTGGCGAGGAAGGTGGGGTGG - Intronic
1157244423 18:46040887-46040909 TTCAGGCCAGGAGAGGGAGAAGG + Intronic
1158988758 18:62847259-62847281 CACTGTCCAGCAAGGAGAGATGG + Intronic
1159777502 18:72620378-72620400 CTCTCAGCAGGAAGGGGAGCTGG + Intronic
1159825387 18:73202341-73202363 CTCTGGGGAGCAAGGGGAGTAGG - Intronic
1159946970 18:74451042-74451064 CCCTGGCCAGGAAAGGGTGGGGG + Intronic
1160343054 18:78106199-78106221 CTCTGGCCATGAAAGGGATTAGG - Intergenic
1160942607 19:1627420-1627442 CTCTTGCCTGCAAGGGGAGAAGG + Exonic
1161051710 19:2167407-2167429 CACTGGCCAGGCAGGGCAGCAGG - Intronic
1161753428 19:6114129-6114151 CTCTGGCCAGGGCTGGGAGCGGG - Intronic
1162027922 19:7904652-7904674 CTGTCGCCAAGAGGGGGAGAAGG - Intronic
1162128635 19:8512302-8512324 CCCTGACCAGGAAGGGAGGAAGG + Intronic
1162241983 19:9362672-9362694 CTTTGGTCAGGAAGAGGGGAGGG + Intronic
1162322266 19:9977364-9977386 TTCTGGCGAGGAAGGGGACAAGG - Exonic
1162324843 19:9993022-9993044 CACTGGCCAGGCTGGGGAGCCGG - Exonic
1162561162 19:11418884-11418906 TTCTGGCCGGGAAGGGGCGTGGG - Intronic
1162934667 19:13975803-13975825 CTTTGGCCAGGGTGGGGATAGGG + Intronic
1163484515 19:17577936-17577958 CTCTGGAGAGGAGGAGGAGAGGG - Exonic
1164397654 19:27879995-27880017 CTCTGGCTAGGAAGAGAAGTGGG - Intergenic
1165080939 19:33305632-33305654 CTCTGGCCAAGACGGAGAGGGGG + Intergenic
1165358773 19:35320710-35320732 CTCTGCCCAGGATGGTAAGACGG - Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166526237 19:43511809-43511831 CTCTGGTTAGGAAGGTGATATGG + Intronic
1166657974 19:44626230-44626252 CCCTGGCCAGGGAGGTGAGGTGG - Intronic
1166822789 19:45590936-45590958 CGCTGGCCAGAAAGCGGAGCAGG + Exonic
1167036773 19:46999515-46999537 CCCTGGCCTGGAAGGGGTGCTGG + Intronic
1167505774 19:49870289-49870311 CCTAGGCCAAGAAGGGGAGAGGG - Intronic
1168270234 19:55245793-55245815 CCCTGTCCAGGAAGGGGAAAGGG + Intronic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
1202691358 1_KI270712v1_random:97184-97206 GTCAGGCCAGGAAGGGGCCAGGG - Intergenic
925868501 2:8249386-8249408 CTCTGGCCAGGACCCGGAGCTGG + Intergenic
925920432 2:8634221-8634243 TTCTGTCCAGGAAAGGGATAGGG - Intergenic
925947032 2:8874773-8874795 TTCTGTGCAGGAAGGGGAGGAGG - Intronic
925954958 2:8954561-8954583 CTCTACACAGGAATGGGAGATGG + Intronic
926038565 2:9654597-9654619 CCCAGCCCAGGCAGGGGAGACGG + Intergenic
926123874 2:10259441-10259463 CTGTGGCCTGGAAGGGGTGGTGG + Intergenic
926553634 2:14331134-14331156 CTCTAGCAGGGAAGTGGAGAAGG + Intergenic
927207508 2:20619407-20619429 CTCTGGGCAGGATGGGTGGAGGG - Intronic
927315460 2:21676113-21676135 CTTTCTCCAGGAAGGAGAGAGGG + Intergenic
927498167 2:23564371-23564393 GGGTGGCCAGGAGGGGGAGAGGG + Intronic
928108733 2:28489664-28489686 TTCTCCCCAAGAAGGGGAGAAGG + Intronic
928176488 2:29037588-29037610 CTCAGGCCAGGAAGTGGGGTGGG - Intronic
928200439 2:29244528-29244550 CACTGGCCAGGAAGGTGCTAAGG - Intronic
928262764 2:29782504-29782526 CGCTGGCCAGGCACAGGAGAGGG - Intronic
929044062 2:37773550-37773572 CTCTGGGCAGGGAGGGGCCAAGG - Intergenic
929133702 2:38602890-38602912 CTCCGGGCAGGGAGCGGAGACGG - Exonic
929587871 2:43127364-43127386 CTCTGGCCAAGGATGGGAGGCGG + Intergenic
929818826 2:45257497-45257519 CTCTGGCTAGGCAAGGGGGAGGG - Intergenic
929886026 2:45879311-45879333 CTCTCAGCAGGAAGGGGAGCGGG - Intronic
931515375 2:63048039-63048061 CTCGAGCCGGGAAGGGGCGAGGG - Intergenic
931798149 2:65731736-65731758 GGCTGGCCAAGAAGGGAAGATGG + Intergenic
931906188 2:66846372-66846394 CTCTGGTCAGTAATTGGAGATGG - Intergenic
932173745 2:69580306-69580328 GTCTGGCAAGGATGGGGAAAGGG - Intronic
932238844 2:70142106-70142128 CTCCGGCCAGGTCGGGGAGGAGG - Intergenic
932369892 2:71178251-71178273 ATCTGGACAGGCAGAGGAGAGGG - Intergenic
932740846 2:74290138-74290160 GTCTGGCCTTGAAGGGGAAAGGG - Intronic
933955032 2:87356766-87356788 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
934029029 2:88024975-88024997 CTGTGGCCTAGAAGGGGAAAAGG - Intergenic
934239223 2:90252980-90253002 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
934273962 2:91563718-91563740 GTCAGGCCAGGAAGGGGCCAGGG - Intergenic
934308358 2:91843540-91843562 CCCTGGCCAGGAGAGGGACAGGG - Intergenic
934461664 2:94216334-94216356 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
934473674 2:94578137-94578159 CTCTGCCCAGAAAGGGCACAGGG + Intergenic
934486914 2:94724612-94724634 GTCAGGCCCGGAAGGGGAGAAGG + Intergenic
934488528 2:94739294-94739316 GTCAGGCCCGGAAGGGGAGAAGG - Intergenic
934558332 2:95299227-95299249 GCCTGGCCAGGGAGGGGAGTGGG + Intronic
934653059 2:96103361-96103383 CACTGGCCATGAAAGGCAGAGGG + Intergenic
935175907 2:100648535-100648557 CTCTCAGCAGGAAGGGGAGCTGG - Intergenic
935250018 2:101252930-101252952 CTCGGGCCGGGAAGAGGGGAAGG + Exonic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
936657625 2:114506348-114506370 CTCTCAGCAGGAAGGGGAGCTGG - Intronic
937223552 2:120355582-120355604 CTCTGGCCAGGTGGATGAGATGG + Intergenic
937392002 2:121497060-121497082 CAAAGGCCAGGAAGGGGAGGGGG + Intronic
937609317 2:123840865-123840887 CTCTGTGCAGGAAGGTGAGGTGG - Intergenic
937646775 2:124274505-124274527 CGCTGGCCAGGGAATGGAGAAGG + Intronic
937909218 2:127067428-127067450 CTATGGCCAGGATGGTGAGATGG + Intronic
937934264 2:127230127-127230149 CTCTGCCCAGGAAGGTGGGGAGG - Intergenic
939611842 2:144320533-144320555 CTTTGGGCAGGAAGAGGACAAGG + Intronic
940379969 2:153002938-153002960 CAGAGGCCAGGAAGGGTAGAGGG + Intergenic
941157893 2:162001322-162001344 CTCTGGCTAGGGAGCAGAGAAGG + Intronic
942483886 2:176419281-176419303 CTCTGACCTGGCTGGGGAGATGG - Intergenic
943733280 2:191325958-191325980 ATCTGGAAATGAAGGGGAGATGG + Intronic
944156703 2:196614867-196614889 CAGAGGCCAGGAAGGGTAGACGG - Intergenic
944944891 2:204672388-204672410 CACTGGACATGAAGGGCAGATGG + Intronic
945300305 2:208209786-208209808 TCCTGAGCAGGAAGGGGAGAGGG - Intergenic
946409606 2:219509532-219509554 CTCAGGGAAGGAAGGGGAGCAGG - Intergenic
946537803 2:220650359-220650381 CTCTGATGAGAAAGGGGAGAGGG - Intergenic
946879699 2:224164510-224164532 CTCTGTGCAGGAGTGGGAGATGG - Intergenic
947523690 2:230866007-230866029 CTCTGGCCGGGGGGGAGAGAAGG + Intronic
947633262 2:231666897-231666919 CCCGGGACAGGAAGGGGTGAAGG + Intergenic
948161362 2:235827594-235827616 CCCTTGGAAGGAAGGGGAGAGGG + Intronic
948840954 2:240648666-240648688 TTAAGGCCAGGAAGGGGAGATGG - Intergenic
948863827 2:240765570-240765592 CGCTGGGCAGGTAGGGGAGGGGG - Intronic
948864030 2:240766402-240766424 CACTGGGCAGGCAGGGGAAACGG + Intronic
949003006 2:241628136-241628158 CTCTGACCAGAATGGAGAGAAGG - Intronic
1168843931 20:929178-929200 TTCTGGCCATGATGGGAAGAGGG - Intergenic
1169005094 20:2200142-2200164 ATCTGGACAGTAAGGGGATAGGG - Intergenic
1169207255 20:3747522-3747544 TTCTGACCAGATAGGGGAGAGGG - Intronic
1169365507 20:4988902-4988924 CTCTGTCAAGGAAAGGGAAAGGG + Intronic
1169589878 20:7128765-7128787 CCCTTGCTAGGAAGGGGATAAGG - Intergenic
1172068014 20:32235186-32235208 CTCTGGCCAGGCAGTGGGGATGG - Exonic
1172227573 20:33315302-33315324 CTCAACCCAGGAAGTGGAGAGGG + Intergenic
1172308769 20:33900759-33900781 CTAACTCCAGGAAGGGGAGAGGG + Intergenic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1173000158 20:39099663-39099685 CTCAGGCCAAGAAGGGCAGTGGG - Intergenic
1174310342 20:49648380-49648402 CTCTTGCCAGGATGGGGAAATGG + Intronic
1174959843 20:55143454-55143476 CTCTGCTCAGGTAAGGGAGAGGG + Intergenic
1175291469 20:57878830-57878852 CTCTGACCTGCAAGGGGAGGTGG + Intergenic
1176051302 20:63120936-63120958 CTCTGGTGGGCAAGGGGAGATGG - Intergenic
1176239093 20:64067724-64067746 CTCTGGCCAGGACAGGCAGGAGG + Intronic
1176592753 21:8659317-8659339 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1176839748 21:13828663-13828685 GTCAGGCCCAGAAGGGGAGAAGG - Intergenic
1179518146 21:41923890-41923912 TACTGGCCAGGAGGAGGAGAGGG + Intronic
1179622878 21:42630408-42630430 CTCTGGCCAGCAAATGGAGAAGG - Intergenic
1179710554 21:43210756-43210778 CCCTGGCCAGGTCTGGGAGAGGG + Intergenic
1180144582 21:45912205-45912227 CCCTGCCCAGGAAGGAGATAGGG - Intronic
1180275606 22:10636459-10636481 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1180535446 22:16390620-16390642 CCCTGGCCAGGAGAGGGACAGGG - Intergenic
1180550084 22:16531399-16531421 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1180616271 22:17130198-17130220 CTCTGTCTAGGAAGAGGAAATGG - Intronic
1180856119 22:19046753-19046775 CTCTGGCCGTGCAGGAGAGAGGG + Intronic
1181423727 22:22819374-22819396 CTCAGGCCAGGCAGGTGGGAAGG + Intronic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181530476 22:23514385-23514407 CTCGAGCAAGGAAGGGCAGAGGG - Intergenic
1181604249 22:23970857-23970879 CTACTGCCAGGAAGGGGTGATGG + Intronic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181767993 22:25105684-25105706 CTCCTTCCAGAAAGGGGAGAGGG - Intronic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182284150 22:29234169-29234191 CTCTGGCCACCCAGGAGAGAAGG + Exonic
1182397198 22:30045252-30045274 GTCAGGCCAAGAAAGGGAGAAGG + Intergenic
1182573145 22:31254180-31254202 CTCTGGCCAGGCCCAGGAGAGGG - Intronic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1182702831 22:32254277-32254299 CTCTGGCCAGGGTGCTGAGAGGG + Intronic
1183706258 22:39476493-39476515 CTCTGGCCATCCAGGGAAGATGG + Intronic
1184168281 22:42743469-42743491 CCCTGGCGGGGAAGGTGAGAGGG - Intergenic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1184327925 22:43805536-43805558 CACAGGCCAGGAAAGGTAGAGGG + Intronic
1184608391 22:45587252-45587274 CTCTGGCCGGGCAGCGGGGATGG - Intronic
1184608405 22:45587309-45587331 CTCTGGCCGGGCAGCGGGGATGG - Intronic
1184608419 22:45587366-45587388 CTCTGGCCGGGCAGCGGGGATGG - Intronic
1184608433 22:45587423-45587445 CTCTGGCCGGGCAGCGGGGATGG - Intronic
1184691509 22:46119427-46119449 CTCTGGCCTGGCAGGGGCGGTGG - Intergenic
1185103453 22:48854028-48854050 CTCTGGCCAGGGAGAGGCCAGGG - Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949700154 3:6747122-6747144 CTGTCACCAGGAACGGGAGAAGG - Intergenic
949987431 3:9552261-9552283 CTCTTGGCAGGTAGGGGAGGGGG - Exonic
950032399 3:9861681-9861703 CTGTGGCCAGGCAGGGGGCAGGG - Intergenic
950312177 3:11968318-11968340 CTCTGGTCAGGAGGTAGAGAGGG - Intergenic
950706914 3:14788555-14788577 ATGTGGCCAGGGAGGTGAGATGG + Intergenic
951486802 3:23222005-23222027 CAGAGGCCAGGAAGGGGAGTGGG - Intronic
953108019 3:39904622-39904644 CTCTGGCAGGTAAGTGGAGAAGG + Intronic
953256612 3:41296866-41296888 ACCTGGAGAGGAAGGGGAGAGGG + Intronic
953596312 3:44318121-44318143 GTCAGGCCAGGAAGGGGAGAAGG + Intronic
953964843 3:47296197-47296219 CTCAGACCAGTAAGGGGAGTAGG - Intronic
955221453 3:57026628-57026650 CCCTGTCCAGGTAGGGTAGATGG - Intronic
955321563 3:57978359-57978381 CCCTGACCAGGAAAGGGCGACGG - Intergenic
955694032 3:61617639-61617661 CTCTGGCAAGGAAGGCAAGAGGG - Intronic
956877670 3:73479708-73479730 CTGGGGTCAGGCAGGGGAGATGG - Intronic
956890821 3:73612578-73612600 ATCTGGCAAGGAAGCAGAGAAGG + Intronic
959679582 3:109078767-109078789 CTTTGGCCAAGAAAGAGAGATGG + Intronic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
961369921 3:126422905-126422927 ACCTGGCCAGGCAGGGCAGAGGG + Intronic
961442344 3:126960507-126960529 CCCTGGCCTGGCAGGGGAGATGG + Intergenic
961446907 3:126985192-126985214 CTCAGGCCAGGAAAGGGAAGGGG + Intergenic
961487581 3:127227542-127227564 CTCTGGCCAGGAGAGGGGCAGGG + Intergenic
961614783 3:128170141-128170163 CTCGGGCCAGGCGGGGGAGGCGG - Intronic
961928014 3:130503637-130503659 GTCTTGTCAGGAAGGGGAAATGG + Intergenic
964475836 3:157096802-157096824 CTCTGCCCAGGAATGAGACATGG - Intergenic
965798559 3:172467430-172467452 CTCTGGCCAGTATGGAGAGGAGG + Intergenic
966428653 3:179808415-179808437 CTCTGTTCTGGAAGGGGTGAAGG - Exonic
966988362 3:185202975-185202997 CAAAGGCCAGGAAGGGGAGGGGG + Intronic
968286888 3:197514073-197514095 CTGTGGCCGGGTAGGGGAGGAGG - Intronic
968425914 4:523224-523246 CTCAGCCCAGGCAGGGGAGCCGG - Intronic
968815352 4:2818755-2818777 CTCTGGGCAGGGAGGGGTCAGGG - Intronic
968915570 4:3495720-3495742 GCCTGGCCAGGCAGGGGACAGGG + Intronic
968940707 4:3636115-3636137 ATCAGGCTAGGAAGGGGAGATGG - Intergenic
968940721 4:3636185-3636207 ATCAGGCTAGGAAGGGGAGATGG - Intergenic
969059800 4:4425655-4425677 GTCTGGAGAGGAAGGGGAGGTGG + Intronic
969079613 4:4608183-4608205 CCGGGGCCAGGAAGAGGAGAGGG + Intergenic
969225955 4:5798511-5798533 CTCTGGCCAGGACTGGGATGTGG - Intronic
969244741 4:5924984-5925006 CCCTGGCCAGGAAGGGGAGTGGG + Intronic
969457734 4:7309773-7309795 CTGTGTCCAGGCTGGGGAGAGGG + Intronic
969566262 4:7980189-7980211 TTCAGGCCATGAAGGGAAGAGGG + Intronic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
972374340 4:38456592-38456614 CTGTAGCCAAGAAGGGGATAGGG - Intergenic
974344601 4:60662502-60662524 CTCTCAGCAGGAAGGGGAGCTGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976218748 4:82739273-82739295 TCCTGGCCTGGAAGTGGAGAGGG + Intronic
977357849 4:95969334-95969356 CTCTCAGCAGGAAGGGGAGCTGG - Intergenic
978119150 4:105057457-105057479 TTCTGGCCAGCTAGGAGAGAAGG + Intergenic
978606441 4:110485403-110485425 CTCTGGAAAGGAAGGGGAAGGGG - Intronic
979799953 4:124896058-124896080 TTCTTGCCAAGAAGTGGAGAAGG + Intergenic
981545767 4:145891823-145891845 GTCTCTCCAGGAAGGGGAGCAGG + Intronic
983118621 4:163851688-163851710 ATGTGGCCAGGAAAAGGAGATGG - Intronic
983634034 4:169880049-169880071 CACTGGCCAGGGAATGGAGAAGG - Intergenic
984543813 4:181074448-181074470 CTCTCAGCAGGAAGGGGAGCTGG - Intergenic
985481268 5:112304-112326 CTCTGGCCTGCAGTGGGAGAAGG - Intergenic
985763728 5:1765435-1765457 CTCTGGCCAGGTGGCGGGGACGG + Intergenic
986494659 5:8330455-8330477 CAATGGCAAGGAAGAGGAGATGG - Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987373956 5:17217563-17217585 CACTGGGCAGGAAGGGGAGGGGG + Exonic
988304811 5:29480805-29480827 GCCTGGTCAGGAAGTGGAGAGGG - Intergenic
990128409 5:52548333-52548355 CTCTTGGCAGGATGGGGAGCTGG - Intergenic
990476285 5:56164343-56164365 CCAGGGACAGGAAGGGGAGACGG - Intronic
990615285 5:57501384-57501406 TTCTGGCGAGGAAGGACAGAGGG + Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991964412 5:72076986-72077008 CCCTGGGCCAGAAGGGGAGAAGG - Intergenic
992009702 5:72514179-72514201 CTACCTCCAGGAAGGGGAGAGGG - Intergenic
992193023 5:74312668-74312690 CTCAGGCCATGATGGGAAGAGGG + Intergenic
992507208 5:77398691-77398713 CTGTGGCCCGGAAGGGCAGCAGG - Intronic
993036251 5:82760800-82760822 CTCTCAGCAGGAAGGGGAGCTGG - Intergenic
995621376 5:114029817-114029839 CTCTGGCCAGCCAAGGGACAGGG + Intergenic
996921266 5:128770136-128770158 CTTTGCCCAGGAAAGGGAGAGGG + Intronic
997616657 5:135251108-135251130 CACAGGCCAGGAAGAGGAGGAGG + Intronic
997724092 5:136105855-136105877 CCCGGGCAAGGAAGGGGATAAGG - Intergenic
997834688 5:137182702-137182724 CTCTGGCCAGCATGGGGTGTTGG + Intronic
998165166 5:139838605-139838627 CTGGGGACAGGAGGGGGAGAGGG - Intronic
998597924 5:143553495-143553517 CCCTTGCCAGGAAGGAGTGAGGG - Intergenic
999262402 5:150245887-150245909 CTCTGGCCAGGAGGTGAGGAGGG - Intronic
999744862 5:154584297-154584319 TACTGGCCAGGAAGGGAACAAGG + Intergenic
1000233462 5:159336269-159336291 CTCTCCACAGGAAGGGGAGGTGG - Intergenic
1001118890 5:168962589-168962611 CTTTGGCCAACCAGGGGAGATGG - Intronic
1001396504 5:171422218-171422240 CTCTGGCCAGGAGGTGGAGGTGG - Intronic
1001442157 5:171751214-171751236 CTTAAGCCAGTAAGGGGAGACGG - Intergenic
1001796342 5:174505335-174505357 TTCTGGCAAGGATAGGGAGAGGG - Intergenic
1002166392 5:177350142-177350164 CTCGGGGCAGGAAGGAGAGGAGG + Intronic
1002278055 5:178115776-178115798 CCCTGGCCAGGAAGCAAAGAAGG - Intronic
1002427476 5:179184828-179184850 CTCCTGCCAGGAGGCGGAGAGGG + Intronic
1002634137 5:180598773-180598795 CTGGGCCCAGGAAGGGGAAACGG + Intergenic
1003674809 6:8193206-8193228 CTCAGGCCATGATGGGAAGATGG + Intergenic
1004532469 6:16465980-16466002 CTGTGTCCAGGAAGCTGAGATGG + Intronic
1005393632 6:25359196-25359218 TTCTGGCCAGGAAAGGAAGCTGG + Intronic
1005458957 6:26049293-26049315 CTCTGTCTAGGAAGTGGACAAGG + Intergenic
1005898335 6:30196750-30196772 CAGGGGGCAGGAAGGGGAGAAGG + Intronic
1005990588 6:30899465-30899487 GTGTGTCCAGGAAGGGGAGAAGG - Intronic
1006239161 6:32662211-32662233 CTCTGTCCTGGATGGGGAGATGG + Exonic
1006248300 6:32759094-32759116 CTCTGTCCTGGATGGGGAGATGG + Exonic
1006361229 6:33588569-33588591 CTGAGGGCAGTAAGGGGAGATGG - Intergenic
1006406454 6:33848539-33848561 CTCTGGACAGGAGGGAGAGCTGG - Intergenic
1006582820 6:35086636-35086658 CACTGGGCAGGAAGGGGATATGG - Intronic
1006741456 6:36311970-36311992 CTATGACCAGGAAGGGAAGGTGG - Intergenic
1007026255 6:38578138-38578160 CCCTGGCCAGGGAAGGTAGAGGG - Intronic
1007134298 6:39506829-39506851 ATCTTCACAGGAAGGGGAGAAGG + Intronic
1007169434 6:39852330-39852352 CCCTGGACAGGGAGAGGAGAAGG - Intronic
1007364445 6:41381532-41381554 CTCTGGCAAGGACTTGGAGAGGG + Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007834663 6:44665308-44665330 GTCTGGGAAGGAAGGGGAGGAGG - Intergenic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008579877 6:52897416-52897438 CTCTGGCCAGGGTGGGCAGCAGG - Intronic
1008880384 6:56375435-56375457 ATCTGGCCAGGAAGGAGGCAGGG - Intronic
1008897231 6:56570229-56570251 CACAGGCCAGGGAGGGGGGATGG + Intronic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1009942467 6:70305001-70305023 CTCTGGTAAGAAAGGAGAGAGGG + Intergenic
1013512946 6:110860158-110860180 GTCAGGCCCAGAAGGGGAGAAGG - Intronic
1014252206 6:119126837-119126859 CTCTCAGCAGGAAGGGGAGCTGG + Intronic
1014419628 6:121226752-121226774 GTATGGTCACGAAGGGGAGAAGG + Intronic
1014774116 6:125488828-125488850 CTCAGGCCATGCAAGGGAGAGGG + Intergenic
1015350280 6:132210138-132210160 CTCTGGTCATGAAGCAGAGAGGG + Intergenic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1015614693 6:135062801-135062823 GGCTGGCCAAGAAGGGAAGATGG - Intronic
1015748523 6:136536685-136536707 CTCTGGGCAGTAAAGGGACATGG - Intronic
1016974133 6:149790673-149790695 GTCAGGCCCAGAAGGGGAGAAGG + Intronic
1017123302 6:151044243-151044265 CTCTGCCCAGAAAGGGCAGAGGG - Intronic
1017158349 6:151342030-151342052 CTCTGGCTTGAAAGGGGAGTCGG + Intronic
1018258596 6:161947557-161947579 CTCGGGCCAGGCAGGTGTGAAGG - Intronic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019542593 7:1558272-1558294 CTTTGGCCAGGCAGGGGTGCTGG + Intronic
1019729469 7:2622390-2622412 GCCTGGCCAGGCAGGGGAGGGGG + Intergenic
1020087924 7:5321419-5321441 CTGGGGCCAGGCAGGGGAGGGGG - Intronic
1020714927 7:11661015-11661037 CTATGGCCAAGAAGTGAAGAAGG + Intronic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1023849098 7:44140492-44140514 CTGTGGCCAGGATGGAGGGAGGG - Intronic
1023960461 7:44922068-44922090 CCCTGGTGAGGAAGGGGAGGAGG - Intergenic
1024005546 7:45222794-45222816 CTCAGGAGAGGAAGGGGAGTAGG - Intergenic
1024035736 7:45506186-45506208 AACTGGACAGGAAGGGGAGCTGG - Intergenic
1024172926 7:46809192-46809214 CTCTGGCCAGAAGGGGCAAAGGG - Intergenic
1024276331 7:47679980-47680002 TTCAGGCCATGACGGGGAGAGGG + Intergenic
1024654124 7:51434771-51434793 CTGTGCCCAGGAAGAGGAGGCGG - Intergenic
1025014106 7:55424983-55425005 CAATGGCCAGGAAGGTGAGTGGG - Intronic
1025624280 7:63205776-63205798 CTCTGGAAAGGAAGGGGAAGGGG - Intergenic
1026001036 7:66558834-66558856 TTCTGGGCAGGAAAGGGAGTGGG + Intergenic
1026600031 7:71770232-71770254 CTCTGGTCAGGAGGTAGAGAGGG + Intergenic
1026807263 7:73436133-73436155 CTCTGGCTGGGAAGGGGGGAAGG + Intergenic
1026822138 7:73557145-73557167 CACTGCCCAGGAAGAGGGGAGGG + Intronic
1026871723 7:73856895-73856917 GGCTTGGCAGGAAGGGGAGAAGG + Intergenic
1026907324 7:74069951-74069973 CGCTGGCCTGGATGGGGATAAGG + Intergenic
1027138116 7:75638966-75638988 CGCCGGCTAGGAGGGGGAGAAGG + Intronic
1027198457 7:76047683-76047705 CTCTGGCCTCCAAGGGCAGAAGG + Exonic
1027789173 7:82617321-82617343 CTGAGGACAGGAAGGGGAAAAGG - Intergenic
1028577627 7:92369887-92369909 CTCTGTCCATGGAAGGGAGAGGG + Intronic
1028582185 7:92420027-92420049 CACTGGCCAAGAAGGGGACAGGG - Intergenic
1028984571 7:96999332-96999354 CTAGGGCCAGGAGGTGGAGATGG - Intergenic
1029653476 7:101909441-101909463 CTCTGGCTAGAAAGGGGTGGTGG - Intronic
1029736252 7:102467542-102467564 CCCTGGCCATGAAGGGCTGAGGG + Intronic
1030262590 7:107580604-107580626 CCCCGGTCAGGAAGGGGAAAAGG - Intronic
1031018155 7:116597764-116597786 CTCTGTCAAGGAAGAGCAGAAGG + Intergenic
1031390473 7:121207801-121207823 CTTTGGTCAGGAAGGGGAATGGG + Intronic
1033128049 7:138721943-138721965 CTCTGGCCAGAACGGCTAGAAGG + Exonic
1033267349 7:139897600-139897622 GTCTGGCCAGGAAGAGGACCAGG + Intronic
1033604093 7:142912754-142912776 CTCCGCCCAGGAAGAGGACATGG + Intronic
1033986193 7:147228401-147228423 CCCTGAGCAGGAAGGGGAAAGGG + Intronic
1034473173 7:151267064-151267086 CTCTTGGCAGGACGGGGAGTGGG - Intronic
1034513153 7:151552713-151552735 CGCTGGCCAGGAGGGAGTGAGGG + Intergenic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035624779 8:1062646-1062668 CTATGGCCAGGAGGGAGGGAGGG - Intergenic
1035754960 8:2023952-2023974 CACGGGCCAGGAGGGGGAGGCGG + Intergenic
1036670510 8:10782339-10782361 CTCTTGCCATGAAGGGAAAATGG + Intronic
1036702584 8:11022961-11022983 CTGTGGCCAGGAAGGGAGGGAGG - Intronic
1037479916 8:19294937-19294959 CCCTGGCCAGGAAGAGTACAGGG + Intergenic
1037518148 8:19653948-19653970 TCCTTGCAAGGAAGGGGAGAGGG - Intronic
1037578187 8:20227820-20227842 TTCTGGAGAGAAAGGGGAGATGG - Intergenic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1039662932 8:39486982-39487004 CTTAGGCCAGGCAGGGGAAAAGG - Intergenic
1039895004 8:41710803-41710825 CACTGGTCAGGAAGAGGAAAGGG + Intronic
1041013440 8:53567412-53567434 CTCTGGAGAGGAAGAGGAAAAGG - Intergenic
1043662680 8:82764676-82764698 CTCTGTCAAATAAGGGGAGAGGG - Intergenic
1044889679 8:96820471-96820493 CAGAGGCCAGGAAGGGGAGAGGG - Intronic
1045082437 8:98642209-98642231 CAGAGGCCAGGAAGGGGAGCGGG + Intronic
1046785678 8:118263811-118263833 CTGTGGTCAGGCAGTGGAGATGG + Intronic
1049222134 8:141433014-141433036 CGCTGGCCAGGAGGGGAAAAGGG + Intergenic
1049429008 8:142550662-142550684 CCCTGCCCAGGAAGGGGAGGTGG + Intergenic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1051748656 9:20319048-20319070 CTCTAACCAGGGAGGGGAGGGGG - Intergenic
1051916622 9:22216728-22216750 CACTGCCAAGGAAGGGGGGAGGG - Intergenic
1052535623 9:29742930-29742952 CACTGGACAGGCAAGGGAGAAGG - Intergenic
1052950108 9:34201988-34202010 GTCTGGCAAGGTAGGGGGGAAGG + Intronic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053562562 9:39211009-39211031 CAATGGCCAGGAAGGGTAGAGGG - Intronic
1053583887 9:39436187-39436209 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1053669260 9:40345070-40345092 GTCAGGCCCGGAAGGGGAGAAGG + Intergenic
1053670880 9:40359717-40359739 GTCAGGCCCGGAAGGGGAGAAGG - Intergenic
1053684656 9:40510375-40510397 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1053692137 9:40591986-40592008 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1053828366 9:42049001-42049023 CAATGGCCAGGAAGGGTAGAGGG - Intronic
1053919061 9:42971310-42971332 GTCAGGCCCAGAAGGGGAGAAGG + Intergenic
1053920683 9:42986090-42986112 GTCAGGCCCAGAAGGGGAGAAGG - Intergenic
1053934622 9:43138653-43138675 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1054105468 9:60994931-60994953 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1054134589 9:61408030-61408052 CAATGGCCAGGAAGGGTAGAGGG + Intergenic
1054272663 9:63045499-63045521 GTCAGGCCAGGAAGGGGCCAGGG - Intergenic
1054279070 9:63114590-63114612 CTCTGCCCAGAAAGGGCACAGGG + Intergenic
1054297750 9:63345837-63345859 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1054303395 9:63392952-63392974 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1054380393 9:64485092-64485114 GTCAGGCCCGGAAGGGGAGAAGG + Intergenic
1054382000 9:64499779-64499801 GTCAGGCCCGGAAGGGGAGAAGG - Intergenic
1054395766 9:64650348-64650370 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1054402175 9:64719462-64719484 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1054430410 9:65155543-65155565 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1054435780 9:65203777-65203799 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1054494613 9:65817910-65817932 GTCAGGCCAGGAAGGGGCCAGGG - Intergenic
1054499970 9:65865978-65866000 CTCTGCCCAGAAAGGGCACAGGG + Intergenic
1054513733 9:66016584-66016606 GTCAGGCCCGGAAGGGGAGAAGG + Intergenic
1054515356 9:66031220-66031242 GTCAGGCCCGGAAGGGGAGAAGG - Intergenic
1054602193 9:67138453-67138475 CAATGGCCAGGAAGGGTAGAGGG + Intergenic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1056899117 9:90582433-90582455 CTCTGGCCCTGCAGGGGACAGGG - Intergenic
1057272597 9:93659236-93659258 CTCTGACCAGGAAGAAGGGATGG + Intronic
1057909395 9:99005899-99005921 CTCAGGCCAGGTATGGGAGCTGG - Intronic
1057971813 9:99565941-99565963 ATCTGGCAAGGAAGGAGTGAGGG - Intergenic
1058104832 9:100957800-100957822 CTCTGACAGGAAAGGGGAGAAGG - Intergenic
1058824350 9:108761464-108761486 CTCTGGACTGGAAGGGAACATGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1060239154 9:121888089-121888111 GTCTGGTGAGGAAGGGGAGGGGG - Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060867114 9:127009336-127009358 CTCTGTACAGTAAAGGGAGATGG - Intronic
1060965682 9:127711208-127711230 GTCTGGCCAGAAAGGTGGGAGGG - Exonic
1061382185 9:130265409-130265431 CTTTGGCCAGGCAGGGGTGGGGG + Intergenic
1061507369 9:131039083-131039105 TTGAGGCCAGGAAAGGGAGAGGG - Intronic
1061527189 9:131175752-131175774 CTCTCTCCACAAAGGGGAGAGGG - Intronic
1061859930 9:133462802-133462824 ATAAGGCCAGGAAGGGGAGGGGG - Intronic
1061874153 9:133535566-133535588 CTCTGGCCTGGCAGGGGTGAGGG + Intronic
1061988695 9:134145685-134145707 CCCTGGCCAGAGAGGGGACAGGG - Intronic
1062005055 9:134234870-134234892 TGCTGGACAGGAAGGGGAGGAGG - Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062259309 9:135652094-135652116 CTCAGGCCAAGATGGGAAGAGGG - Intergenic
1062275542 9:135728650-135728672 CACGGGCTGGGAAGGGGAGAGGG + Intronic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062522515 9:136964128-136964150 CCCAGGCCTGGCAGGGGAGAGGG + Intergenic
1203622798 Un_KI270749v1:138123-138145 GTCAGGCCAGGAAGGGGCCAGGG + Intergenic
1185494889 X:546888-546910 CTCTGGGCAGAAATGGGATAAGG - Intergenic
1186434645 X:9532471-9532493 CTCTCTCCAGGAATTGGAGAGGG + Intronic
1186444559 X:9615728-9615750 CTCTGGCCAAGGATGGGAAAGGG - Intronic
1187155110 X:16714460-16714482 CTGTGACAAGGAAAGGGAGAAGG + Intergenic
1187410644 X:19048025-19048047 CTTTGGCCAGAACGGGAAGAAGG + Intronic
1187786653 X:22895975-22895997 CTTTGGGCAGGAAGGGGTGGTGG + Intergenic
1189351362 X:40278270-40278292 CTCTGGCAAGGAGGGGCAGCGGG - Intergenic
1189609000 X:42711473-42711495 CGCTGGAAAGGAAGGGAAGAAGG + Intergenic
1190852810 X:54263133-54263155 CTCAGCCCCAGAAGGGGAGATGG + Intronic
1191729091 X:64314676-64314698 TGCTGGCCAGGCAGGGAAGAAGG + Intronic
1191791745 X:64978464-64978486 CTCTGTCCCGTAAGGGGAGGAGG + Intronic
1192173546 X:68871928-68871950 CTCTGACCGGCCAGGGGAGAAGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1195721286 X:107871653-107871675 CTCTCAGCAGGAAGGGGAGCTGG + Intronic
1195751729 X:108166110-108166132 CTTTGGCCAAAAAGGGGGGAGGG - Intronic
1195753105 X:108176743-108176765 CTCTGCCTAGGAATGGGAAATGG - Intronic
1197200915 X:123747741-123747763 TACTGGCAAGGAAGGGGAGTTGG + Intergenic
1197703849 X:129619549-129619571 CTTTGGCCAGGAAGGAAAGAAGG - Intergenic
1198002739 X:132456079-132456101 CTGTGGCCAGGAGGGTCAGATGG - Intronic
1198126297 X:133647359-133647381 CTCTGACCAGCAAGGGCACAGGG + Intronic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198284694 X:135178025-135178047 CTCAGGCCAGAAATGGCAGAAGG + Intergenic
1198405031 X:136303825-136303847 CTCACACCAGGAAAGGGAGAGGG + Intronic
1198447624 X:136733980-136734002 ATCTGGCCCTGAAGGGCAGATGG + Intronic
1198499235 X:137226205-137226227 AAGTGGCCAGGAAGGGAAGAAGG - Intergenic
1200064443 X:153497764-153497786 TTCTGGCCTGGAAGGGGACCTGG - Intronic
1201075622 Y:10185193-10185215 CTCTGGCAAGGGGTGGGAGAAGG - Intergenic
1201788391 Y:17809558-17809580 CTCTGGCCATGGCGGGGCGAAGG + Intergenic
1201813162 Y:18096430-18096452 CTCTGGCCATGGCGGGGCGAAGG - Intergenic
1202115043 Y:21464507-21464529 ATCTGGCAAGGAAGGGAAGTGGG + Intergenic