ID: 1085512739

View in Genome Browser
Species Human (GRCh38)
Location 11:77096518-77096540
Sequence GCCTCCTGCCCTGCTCCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 359}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085512734_1085512739 12 Left 1085512734 11:77096483-77096505 CCCACCTGTTTCTCTGTTCTGTC 0: 1
1: 1
2: 4
3: 40
4: 440
Right 1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG 0: 1
1: 0
2: 1
3: 41
4: 359
1085512736_1085512739 8 Left 1085512736 11:77096487-77096509 CCTGTTTCTCTGTTCTGTCAGAC 0: 1
1: 0
2: 1
3: 32
4: 252
Right 1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG 0: 1
1: 0
2: 1
3: 41
4: 359
1085512733_1085512739 24 Left 1085512733 11:77096471-77096493 CCTCTTAGATGGCCCACCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG 0: 1
1: 0
2: 1
3: 41
4: 359
1085512730_1085512739 27 Left 1085512730 11:77096468-77096490 CCCCCTCTTAGATGGCCCACCTG 0: 1
1: 0
2: 1
3: 9
4: 156
Right 1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG 0: 1
1: 0
2: 1
3: 41
4: 359
1085512732_1085512739 25 Left 1085512732 11:77096470-77096492 CCCTCTTAGATGGCCCACCTGTT 0: 1
1: 0
2: 2
3: 8
4: 92
Right 1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG 0: 1
1: 0
2: 1
3: 41
4: 359
1085512735_1085512739 11 Left 1085512735 11:77096484-77096506 CCACCTGTTTCTCTGTTCTGTCA 0: 1
1: 0
2: 2
3: 45
4: 558
Right 1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG 0: 1
1: 0
2: 1
3: 41
4: 359
1085512731_1085512739 26 Left 1085512731 11:77096469-77096491 CCCCTCTTAGATGGCCCACCTGT 0: 1
1: 0
2: 1
3: 11
4: 87
Right 1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG 0: 1
1: 0
2: 1
3: 41
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085512739 Original CRISPR GCCTCCTGCCCTGCTCCTAC GGG Intronic
900302436 1:1984814-1984836 GCCTCCTGCCCTGCCCAGGCTGG + Intronic
900462822 1:2809612-2809634 GCCACCTGCCCTGCGCCTCAAGG + Intergenic
900568623 1:3347526-3347548 GCCTCTTGCCTTGATTCTACAGG - Intronic
900579526 1:3402220-3402242 GGCTGCTGCCCAGCTGCTACAGG + Intronic
900707486 1:4089712-4089734 GCCTCCTGCACTTCCCCCACGGG + Intergenic
900798445 1:4723487-4723509 GCCTCCTGGCCACCTCCTCCCGG - Intronic
901631714 1:10651302-10651324 GCCTCCCGCCCTTCTCCTCCAGG - Intronic
901929103 1:12585641-12585663 GCCTCCTACCCTGACCCTTCTGG + Intronic
902579999 1:17402261-17402283 GGCTCCCACCCTGCTCCTCCTGG + Intergenic
903229912 1:21915296-21915318 GCCTCCTCCCCTTCTCCCACTGG + Intronic
903884296 1:26531982-26532004 GCCGCCTGACCTGCACGTACAGG + Intronic
904292871 1:29498898-29498920 GCCTCCAGCTCAGCTCCTGCAGG - Intergenic
904297149 1:29527302-29527324 ACCTGCTGCCCTTCTCCTCCAGG - Intergenic
904745406 1:32707679-32707701 GCTCCCTCCCCTGCTCCTTCAGG + Intergenic
905858570 1:41330965-41330987 GCCTGCAGCCCTGCTCCCTCCGG - Intergenic
907048853 1:51316340-51316362 GCCTCCTGACCTGCCCATACTGG + Intronic
907523060 1:55037841-55037863 CCCTCCTGCCTTCCTCCTTCAGG - Intergenic
910137877 1:83994402-83994424 GGCTCCTGACTTGCTCCTCCAGG - Intronic
911377358 1:97067548-97067570 AGCCCCTGCCCTGTTCCTACAGG + Intergenic
912458766 1:109817549-109817571 TCCTCCTGCCCCTCTCCCACAGG - Intergenic
913075161 1:115336065-115336087 GCCTCATTCCTTGCTCCCACTGG + Intronic
914950622 1:152110627-152110649 GCCTCCTCTCCTGATCCTCCTGG + Exonic
915593693 1:156884533-156884555 CCTTCCTGCCCTGCTCCCACAGG + Intergenic
919539380 1:198829261-198829283 CCCTCCAGCCCTGCTCCTCTGGG - Intergenic
920338056 1:205258077-205258099 TCCTCCTGCCCTGACCCTAAGGG - Intronic
920399551 1:205668595-205668617 TCCTCCTGCCCTACTGCTCCTGG + Intronic
921214455 1:212925241-212925263 GCCTCCTCCTCTGCTCCTGAGGG - Intergenic
922700178 1:227754696-227754718 GTGGCCTGCCCTGCTCCTTCAGG + Intronic
923492822 1:234499401-234499423 TCCTCCTGCCCTTCCCCTCCTGG + Intergenic
923934734 1:238747965-238747987 CCCTCCAGTCCTGCTCCTCCTGG + Intergenic
1062909001 10:1199988-1200010 GCCAGCTGCCCGCCTCCTACCGG - Exonic
1064055973 10:12097822-12097844 GCCCCCTGCCCTGAACCTGCAGG + Exonic
1065778478 10:29144384-29144406 GTCACCTTCCCTGCTTCTACTGG + Intergenic
1067061753 10:43081375-43081397 GGCTCCTGCCCTGCTGCTCTAGG + Intronic
1067084782 10:43231971-43231993 GCCTTGTGCCCTGCCCCTAAAGG - Intronic
1067096496 10:43304870-43304892 GCCTCCTGCCCCGCCCTAACAGG + Intergenic
1067293433 10:44960523-44960545 GCCTGCTGCCCTGCTCTTCTGGG + Intronic
1067376595 10:45733015-45733037 GCCATATGCCCTGCTGCTACGGG + Intronic
1067884289 10:50073706-50073728 GCCATATGCCCTGCTGCTACGGG + Intronic
1068780327 10:60912787-60912809 GCCTCCTGTCCAGCTGCTACTGG - Intronic
1069691755 10:70358292-70358314 GCCCTCTGCCCTGCTCCAAGTGG - Intronic
1069729910 10:70603781-70603803 GCTTCCGTCCCTGCTCTTACAGG + Intergenic
1069861058 10:71472104-71472126 ACCTCCAGCCCTGCTCCGAGTGG + Intronic
1070149880 10:73799168-73799190 CCCACCTGCCCTGATCCCACTGG - Exonic
1070285867 10:75083312-75083334 TCCTCTTGGCCTCCTCCTACTGG + Intergenic
1070590541 10:77797593-77797615 TCCTCTTGCCCTGCTCTTTCTGG - Intronic
1070843200 10:79502468-79502490 GATTCCTGCCCTGTTCCCACAGG - Intergenic
1070930470 10:80257166-80257188 GATTCCTGCCCTGTTCCCACAGG + Intergenic
1071201183 10:83221916-83221938 GCCTCCATCCCTGCTACTGCTGG + Intergenic
1074254031 10:111782509-111782531 TCTTCCTCCCCTGCTCATACAGG - Intergenic
1075010841 10:118868966-118868988 GCCTCTTGCCCAGCTCCTTCAGG - Intergenic
1075556181 10:123434296-123434318 TCCTCCTGCCCTTCTGTTACTGG - Intergenic
1075948352 10:126456838-126456860 GCCTCCCTCCCTGCTCCTGGCGG - Intronic
1076534260 10:131166832-131166854 CCCTCCTGCCCTGATGCTGCGGG - Exonic
1076793423 10:132787964-132787986 GCCCCCTGCCCCGCCCCTCCAGG - Intergenic
1077213248 11:1383120-1383142 GCCACCTGCCCTCCCCCCACGGG + Intergenic
1077273751 11:1693857-1693879 GCCCCCTGCCATGTTCCTGCTGG + Intergenic
1077376851 11:2209276-2209298 GGCCCCTGCCCTGCTCTGACAGG - Intergenic
1077528588 11:3083923-3083945 GCCTCCTGCCCTACTGCAGCAGG - Intergenic
1077712738 11:4552648-4552670 CCCTCCAGCCCTGCTCCTCCAGG + Intergenic
1078091769 11:8268519-8268541 GCCGCCTGCGCTGCTCCCGCCGG + Intronic
1079793629 11:24770924-24770946 GCCTGCTGCCCTGCCACTGCAGG + Intronic
1080056442 11:27911464-27911486 GCCACCTCCCCTCTTCCTACTGG - Intergenic
1080840238 11:35977237-35977259 GCCTTCTGCCTTCCTCCAACTGG - Intronic
1080869861 11:36227767-36227789 GGATCCTGGCCTGCTCCTCCTGG + Intronic
1081991373 11:47339402-47339424 CCCTCCTGCCCTGTTCCCAGGGG - Exonic
1082261325 11:50077917-50077939 AGCTCCTGCCCAGCTCCTAGTGG - Intergenic
1082814909 11:57501285-57501307 GCCACCTGCGCTGCTCATCCTGG + Exonic
1083277020 11:61602697-61602719 TCCTCCTCTCCTGCTCCTGCTGG - Intergenic
1083611616 11:64007135-64007157 GCCTCCCGCGCCCCTCCTACTGG + Intronic
1083719548 11:64597640-64597662 GCCACCTGCCCTACACCCACCGG - Intronic
1084446278 11:69205438-69205460 GCGTCCTCTCCTGCTCCTTCTGG + Intergenic
1084561273 11:69906626-69906648 GCCTTCAGCTCTGCTCCTTCTGG - Intergenic
1084589306 11:70080867-70080889 GCTGCCTGCCCTGCACCAACAGG - Intronic
1084775938 11:71375535-71375557 TCCTCCTGCCTTTCTCCTTCTGG - Intergenic
1085037148 11:73307628-73307650 GCCGCCTGTCCGGCTCCGACCGG - Intergenic
1085181006 11:74536001-74536023 GCCTCCCGTCCGGCTCCCACAGG + Intronic
1085470351 11:76753579-76753601 CCCTCCCTCCCTGCTCCTCCTGG - Intergenic
1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG + Intronic
1088696425 11:112370079-112370101 GCCTCCTACCGTGCTTCTAACGG - Intergenic
1089113968 11:116079062-116079084 GTCTCATCCCCTGCTCTTACAGG + Intergenic
1089122353 11:116146266-116146288 CCTTCCAGCCCTGCTCCTCCAGG + Intergenic
1089632102 11:119790198-119790220 GCCTCCTGCACAGCTCCAACAGG - Intergenic
1090265796 11:125352073-125352095 GCTGCCTGCCCTTCTCCTCCTGG + Intronic
1090456233 11:126851970-126851992 GCCTCCTTGCCTGACCCTACTGG + Intronic
1091215234 11:133897186-133897208 GCCTCCTTCCCTTCTCCGTCAGG - Intergenic
1091262358 11:134244916-134244938 GACTCCTGCCCTCCCCCTACAGG + Exonic
1091448627 12:559232-559254 GCCTCCTTCCTTCCTCCTCCTGG + Intronic
1091786241 12:3244856-3244878 TCTTCCTCCCCTGCTCCTCCTGG + Intronic
1092165055 12:6337280-6337302 GCTTCCTGCCCTTCTGCTCCAGG - Intronic
1092243715 12:6851301-6851323 GCCCCCTGCCCTGACCCTATTGG + Exonic
1092244413 12:6855524-6855546 TGCCCCAGCCCTGCTCCTACCGG - Exonic
1092569764 12:9709281-9709303 CCCTCAAGCCCTGCTCCTCCAGG + Intergenic
1093120374 12:15264148-15264170 GCCTCTTGCCTTGCTCCTGGTGG - Intronic
1093369920 12:18354369-18354391 CCCTTCAGCCCTGCTCCTCCGGG - Intronic
1093542000 12:20298664-20298686 CCCTGCTGCCCTGCTGCTGCTGG - Intergenic
1094487168 12:30934262-30934284 GACTCCTGCTCTGCACCTGCTGG + Intronic
1095977942 12:47952467-47952489 CCCTCCTTCCCTGGTCCCACAGG + Intergenic
1096534438 12:52262348-52262370 GCCCCCTGCCCTGCTCTTTCAGG + Intronic
1096558524 12:52419050-52419072 TCCTCCTGCCCAGCTCCCAGTGG - Intergenic
1096974430 12:55691777-55691799 GCCTCATGCCATGCTCCCAGGGG + Intronic
1097022144 12:56027960-56027982 GCCTCATTCCCTCCTCCCACTGG - Intronic
1100016189 12:90013647-90013669 GTCTCTTTCCCTGCTGCTACTGG + Intergenic
1100247893 12:92782751-92782773 GTCTCCTGCCCTTCTTCCACTGG + Intronic
1101216966 12:102594931-102594953 CCCTCCAGCCCTGCTCCTCTGGG - Intergenic
1101512626 12:105406740-105406762 GCTTCCTGCCCTGCCACCACAGG - Intergenic
1102254652 12:111408551-111408573 GCCTCCAGCTCTGCTCCACCTGG - Intronic
1102960591 12:117090954-117090976 GCCACCTGCCCTCCTCCTGGAGG + Intronic
1103727413 12:123004989-123005011 GCCACCTCCACTGCTCCTATGGG + Intronic
1104037008 12:125104552-125104574 GCCACCTCCCCAGATCCTACAGG - Intronic
1106024489 13:25944218-25944240 GCCACCCGCCCAGCTCTTACAGG - Intronic
1106467587 13:30026538-30026560 ACCTCCAGCCCAGCTCCTGCTGG - Intergenic
1106908831 13:34440256-34440278 GCCCCCTTCCCTGGTCCTCCAGG - Intergenic
1107327714 13:39263022-39263044 GCATTCTGCTCTGCTCCTCCTGG - Intergenic
1108976716 13:56453573-56453595 CCCTCCTGCTCTCCTCCAACAGG + Intergenic
1111292497 13:86187048-86187070 CCCTCCAGCCCTGCTCCTCCAGG + Intergenic
1112329762 13:98468415-98468437 ACCTGCTTCCCTGCTCCTAGGGG - Intronic
1113299885 13:109006883-109006905 GACTCCTGGCCTGCTCATATTGG - Intronic
1113772654 13:112920578-112920600 GCCTGCTGCCCTGCGGTTACCGG + Intronic
1113849265 13:113408829-113408851 CCCTCCTCCCCTGCTCCTGGTGG - Intergenic
1114525406 14:23364820-23364842 TCCTCATCCCCTGCTCCTCCTGG - Intronic
1119708973 14:76807558-76807580 GCCTCAGGACCTGCTCCTAGAGG - Intronic
1120745014 14:88144907-88144929 CCCTCAAGCCCTGCTCCTCCGGG + Intergenic
1121074569 14:91057172-91057194 GCCTCCTCCCCTACTACTAGAGG + Intronic
1121685067 14:95829673-95829695 GCAGCCTGCCCTGATCCTCCAGG + Intergenic
1121914522 14:97824544-97824566 GGCTGCTACCCTGCTCATACTGG - Intergenic
1122372580 14:101236815-101236837 TCCTCCTGCCCTGCTGGTAACGG - Intergenic
1122696529 14:103555962-103555984 GCCTCATGCTCTGCTCCCTCAGG - Intergenic
1122961192 14:105094228-105094250 GCCCTCGGCCCTGCTCCTGCTGG - Intergenic
1122981221 14:105193164-105193186 GCCCCCAGCCCTGCTCCTGCCGG + Intergenic
1123039334 14:105483963-105483985 GCGCCCTGGCCTGCTCCTGCTGG - Intergenic
1124126785 15:26944235-26944257 GCCTCCTGCTCTGCTGTAACTGG - Intronic
1126200378 15:45978884-45978906 GCCTCCTCACCTTCTCTTACAGG - Intergenic
1127345694 15:58095672-58095694 GTCTCCTGCCCTGCTCTGACAGG + Intronic
1127757928 15:62111339-62111361 ACCACCTGCTCTGCTCCCACAGG - Intergenic
1129227037 15:74176082-74176104 GCCCCCAGGCCTGCTCCTGCTGG + Exonic
1130706673 15:86239470-86239492 TCCTCCTGCCCTGCAGCTGCAGG - Intronic
1132372144 15:101306576-101306598 GACTCCTGCACTGCACCTCCAGG + Intronic
1132701282 16:1223143-1223165 GCCTCCTGACCAGCCCCTGCTGG - Intronic
1134567078 16:15261012-15261034 GCCTCCCTCCCTCCTCCTCCGGG - Intergenic
1134735415 16:16495688-16495710 GCCTCCCTCCCTCCTCCTCCGGG + Intergenic
1135186838 16:20322815-20322837 CCCTCCTGCCCTGCCCCCTCAGG + Intronic
1135289595 16:21223892-21223914 GCCTCCTGCCCCACGCCCACAGG - Intergenic
1135299093 16:21310293-21310315 GACTCCTGCCCTGCTCATCTCGG + Intergenic
1135567571 16:23523640-23523662 TCCTGCTGCCCAGCTGCTACGGG + Exonic
1136473756 16:30499058-30499080 GCCTTCTGCCCTGCAGCTCCCGG + Exonic
1138420045 16:56892999-56893021 TCTTCTTGCCCTGCTCCGACTGG - Exonic
1138524258 16:57592827-57592849 CCCTCCTGCCCTGCACCACCCGG - Intergenic
1138542138 16:57694937-57694959 GCCTCCAGCCCTGATCTTTCTGG + Intronic
1139382722 16:66543808-66543830 TCCTCCTGCCTTGATCCTAACGG + Intronic
1139655007 16:68382247-68382269 GCCTCCTGCCCCTCCCCTACAGG - Intronic
1140209873 16:72961423-72961445 CCGTCTGGCCCTGCTCCTACAGG + Intronic
1141042256 16:80682626-80682648 GCTCCCTGCCCTGCTCATATGGG - Intronic
1141649498 16:85385507-85385529 GCTTCCTGCCCTGCTCCCCAGGG - Intergenic
1141690585 16:85594174-85594196 GCCTCCTGCCCTGGCCCATCGGG - Intergenic
1142151168 16:88513101-88513123 GCCCCCTCCCCTGCCCCTGCAGG - Intronic
1142673443 17:1498261-1498283 GCCTGCTGCCTTGCTCCCTCCGG - Intronic
1143016156 17:3892378-3892400 GCCACCAGCCCTGCGCCTCCCGG + Intronic
1143537686 17:7550875-7550897 GCCACCTGCCCCTCTCCTCCTGG - Intronic
1143780294 17:9225650-9225672 CCCTCCTGCCCTCCCCCTACTGG - Intronic
1143891833 17:10107947-10107969 TTCTCCTGCCCAGCTCCCACTGG - Intronic
1144029256 17:11304797-11304819 CCCTCATCCCCAGCTCCTACCGG - Intronic
1144726655 17:17505734-17505756 GCCTCCTGGCCTGCCCCAAGTGG - Exonic
1145103598 17:20096885-20096907 GCCTCCTTCCCTGCCCCGAGAGG - Intronic
1146824406 17:36010415-36010437 CCCTCCAGCCCTGCTCCGCCAGG + Intergenic
1147266183 17:39236442-39236464 GGCTCCAGCCCTGCTCAGACAGG + Intergenic
1148552171 17:48557030-48557052 GGCTCCTGTCTTCCTCCTACAGG - Intronic
1149453385 17:56767491-56767513 GCCCACTGCCCTGCTCCTATGGG + Intergenic
1149575412 17:57708293-57708315 GCCTCCTGCTCTGCTCCAATGGG + Intergenic
1149580575 17:57747619-57747641 GCCTGGTGCCCTGCACATACTGG + Intergenic
1149729020 17:58925984-58926006 TCCTCCTCCCCTCCTCCAACTGG + Intronic
1151575698 17:74951688-74951710 TCCTGCTGCCCAGCTCCTCCTGG - Intronic
1151979283 17:77499182-77499204 TACCCCTGCCCTGCTCCTAAGGG + Exonic
1152047117 17:77944455-77944477 GCCACATGGCCTGTTCCTACAGG - Intergenic
1152406747 17:80102161-80102183 GCCACCTCTCCTGCTCCTGCAGG + Intergenic
1152407201 17:80104597-80104619 GGCACCCGCCCTGCTCCCACCGG + Intergenic
1152919084 17:83056870-83056892 CCCTCCTTCCCTGGGCCTACAGG + Intergenic
1152925381 17:83085271-83085293 GCCTCCTAACCAGCTCGTACTGG - Exonic
1153362639 18:4214507-4214529 GCCTCCACCCCAGCTCCAACAGG - Intronic
1157101334 18:44732894-44732916 CCCTCCTGCCCTGGCCCTACCGG + Intronic
1157273742 18:46295360-46295382 CCCTTCTGCCCTGCTCCAGCAGG - Intergenic
1159586346 18:70287226-70287248 CCCTGCTGCACAGCTCCTACTGG + Intergenic
1160793884 19:935037-935059 ACCTCCCGCCCGGCCCCTACTGG + Intronic
1161060741 19:2213595-2213617 GCCTCCTGATCTCCTCCTTCTGG - Exonic
1161105499 19:2441779-2441801 TCCTCCAGCACTGCTCCTTCAGG - Intronic
1161399453 19:4060886-4060908 GCCTCCTTCCCTGCTCTCCCTGG - Intronic
1161468669 19:4445762-4445784 GCCTCCTGCCCTCTCCCTCCGGG + Intronic
1161740604 19:6018822-6018844 CCCTCCAGCTCTGCTCCTGCAGG + Intronic
1161906386 19:7159906-7159928 GCCCCCTGGCCTTCTCCTCCAGG + Intronic
1163020395 19:14478252-14478274 GCCCCCTGCCCCGCTCCAATCGG - Exonic
1163441738 19:17325335-17325357 GCCGCCTGCGCTGCTGCTGCTGG + Exonic
1164530014 19:29041502-29041524 GCCTCCTCCCTTGATCCCACTGG - Intergenic
1164959576 19:32416339-32416361 TCCTCCAGCTCTGCTCCTCCCGG - Intronic
1165091975 19:33392458-33392480 GCCTCCTGCCCTGGCCCCATGGG + Intronic
1166539883 19:43598075-43598097 GCCTCCTTCCTTCCTCCTTCTGG - Intronic
1166675595 19:44738847-44738869 GCCCCCTGCCCTGCTCATTCGGG - Intergenic
1166748890 19:45155436-45155458 GGCTCCTGCCAAGCCCCTACTGG - Intronic
1167155382 19:47735373-47735395 GCCTCATGGCCTCCTCCTGCTGG - Intronic
1167168831 19:47817667-47817689 GCTTCCTCCCCTGCTCCCATGGG + Intronic
1167246699 19:48377298-48377320 GTTTCCTGCCTGGCTCCTACAGG - Intergenic
1167358615 19:49018340-49018362 CCATCCCGCCCTGCTCCCACAGG - Intergenic
1167366307 19:49056595-49056617 CCATCCCGCCCTGCTCCCACAGG - Exonic
1167373871 19:49101077-49101099 GCCTCCTGCCCTCCTGCCCCCGG + Intronic
1168316363 19:55486458-55486480 GCCGCCGGCCCTGCTCCTCCTGG + Exonic
925117965 2:1396335-1396357 GCCTCCTGCCCTGGCCCCAGTGG - Intronic
925203450 2:1987553-1987575 GCCTCCTGCCCACCTGCTTCAGG + Intronic
925343616 2:3154037-3154059 ACCTCCAGCCCTGCTCCTCAGGG + Intergenic
925379889 2:3417345-3417367 GCCTGCTGCTCTCCTCCTGCCGG + Intronic
925571070 2:5313472-5313494 GATTCCTGCCCTGCTCTTAGAGG - Intergenic
925743915 2:7029077-7029099 GACCCCTGACCTGCTCCTCCTGG + Intronic
926037225 2:9645346-9645368 GCCTCCAGCTCTGCTGCTGCTGG + Intergenic
926741278 2:16112704-16112726 TCTTCCAGCCCTGCTCCTCCAGG - Intergenic
927502949 2:23594339-23594361 ACTTCCTGCCCGGCTCCTCCGGG + Intronic
928101450 2:28439865-28439887 GCCCCCAGCCCTGCTCCATCAGG + Intergenic
928690363 2:33792588-33792610 ACCTCCTGCCATTCTCCTACAGG + Intergenic
929041200 2:37746550-37746572 GTTTCCTTTCCTGCTCCTACTGG + Intergenic
930053331 2:47233975-47233997 CTGTCCTGCCCTGCTCCTTCAGG + Intergenic
932230379 2:70078912-70078934 ACCACCTGCCCTGCTGCTACTGG - Intergenic
932593631 2:73081199-73081221 GCCTCCAGCCCCACTCCTGCAGG + Intronic
933141139 2:78793894-78793916 CCCTCCAGCCCTGCTCCTCTGGG - Intergenic
934934095 2:98452118-98452140 GTCTCCTTCCCTGCTCCTGCTGG - Intronic
935594457 2:104868172-104868194 GGCTCCGGCGCAGCTCCTACAGG + Intergenic
935595592 2:104874624-104874646 GCCACCTGCCCAGCTACTTCCGG - Intergenic
935953840 2:108354937-108354959 GCTTACTGCCCTGCCCCTGCAGG + Intergenic
935958527 2:108401395-108401417 CCCTCCAGCCCTGCTTCTCCGGG + Intergenic
936779211 2:116011888-116011910 GCCACCTGCCCTTCCCCAACAGG - Intergenic
936824083 2:116559230-116559252 GCCGTCTGCCCGGCTCTTACAGG + Intergenic
936944880 2:117921374-117921396 GCCTCCTGCCCTTGTTCCACTGG + Intronic
937869273 2:126776317-126776339 GCATCCTTCTCTGCTCCTGCAGG - Intergenic
938112539 2:128578604-128578626 CCCACCTGCCCTGTTCCTGCTGG + Intergenic
938947088 2:136223177-136223199 GCCTCATGCCGTGTCCCTACTGG - Intergenic
939429155 2:142080746-142080768 ACCTCCTCTCCTGCTCCTTCTGG + Intronic
940362709 2:152813369-152813391 GCCTTCAGCCCTGTTGCTACAGG - Intergenic
940785349 2:157975368-157975390 GCCTTCACCCCTGCTCCAACAGG + Intronic
941809321 2:169739459-169739481 GCCACCTGCCCTGGTCAAACTGG + Intronic
942059504 2:172215286-172215308 TCCTGCTGCCCTGCTCGTGCTGG + Intergenic
943383393 2:187176180-187176202 TCCTCCAGCCCTGCTCCTCTGGG - Intergenic
944206701 2:197164589-197164611 GCCCCCTCCCCTGCTGCTGCGGG + Intronic
945999113 2:216465948-216465970 GCCTCCTCCCCTTCACCTCCTGG + Intronic
947473168 2:230415994-230416016 CCCTCCTTCCCTGGTCCTGCAGG + Intronic
947707218 2:232286040-232286062 GCCCTCTGCCATGCTCCAACAGG + Intronic
948061286 2:235044798-235044820 GACTCCTGCCCCACTCCTGCCGG - Intronic
948205287 2:236160035-236160057 GCCTCCAGGCCTGGTCCTGCAGG - Intergenic
948536285 2:238650170-238650192 GCCAGCTGCCCTGCTCCACCAGG - Intergenic
948671999 2:239574724-239574746 CCCTCATGCCCTGCCCCTTCAGG + Intergenic
948803558 2:240443498-240443520 TCCACCTGTCCTGCTCCTTCAGG + Intronic
1169084905 20:2820693-2820715 GCCGCCTTCCCTGTTCCTAGGGG - Intergenic
1169361867 20:4957104-4957126 GCCTCCTTCCCTCTTCTTACTGG + Intronic
1170533911 20:17321591-17321613 GCATCATGCTCTGATCCTACAGG + Intronic
1170651323 20:18245278-18245300 ATCTCCTCCCCTGCTCCTGCTGG - Intergenic
1172093044 20:32447023-32447045 GGCACCTGTCCTGCCCCTACTGG + Exonic
1172122417 20:32606270-32606292 TCCTCCTGCACAGCTCCTCCGGG + Intronic
1172703215 20:36864829-36864851 TCCTCCTGCACTGCTCCTGGTGG - Intergenic
1173273783 20:41560353-41560375 GACTCCTGCCCTGCTCATTCAGG + Intronic
1173854180 20:46239473-46239495 ACCTCCTCCCCTTCCCCTACTGG + Intronic
1174622353 20:51885450-51885472 GCCTCCTGGCCTCCGCCTCCTGG - Intergenic
1176090368 20:63315883-63315905 GCCTCCTGCCCGGTGCCTGCTGG + Intronic
1176100914 20:63364104-63364126 GCCTCTTCCCCTGCACCAACGGG - Intronic
1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG + Intergenic
1179775899 21:43661942-43661964 GCATCTTGCCCTACTCCTCCAGG + Intronic
1180847535 22:18992137-18992159 GCCTCCTGCTCTGCTTCTGTGGG + Intergenic
1180965042 22:19783805-19783827 CCCTCCTGCCCAGCTCCTAATGG + Exonic
1182449697 22:30411955-30411977 GCTTCCTGCCTTGCTCCATCTGG - Intronic
1183326475 22:37197301-37197323 GCCTCCCTCCCTGCTTCTAAGGG + Intronic
1183326548 22:37197667-37197689 GCCAGCTGCCCTGCACCTAGAGG - Intronic
1183704450 22:39468348-39468370 GCCTCATGCCCTGGTGCTGCAGG - Intronic
1184416906 22:44357467-44357489 GCCTCCTCCCCTGCACATAGTGG - Intergenic
1184732874 22:46380620-46380642 GCCTCCTGCTCTGCTTCTGTGGG - Intronic
1184745002 22:46451055-46451077 TCCTCCTCCCCAGCTCCCACCGG + Intronic
1184915076 22:47563599-47563621 GCCTCCTCCCCGGCTCCCCCTGG - Intergenic
1185146859 22:49141893-49141915 GAGACCTGCCCTGCTCCGACTGG + Intergenic
1185272529 22:49935688-49935710 GCCTCCACTCCTGCTCCTCCCGG - Intergenic
1185272634 22:49935927-49935949 CCCTCCGTCCCTGCTCCTCCCGG - Intergenic
1185272650 22:49935962-49935984 CCCTCCGTCCCTGCTCCTCCCGG - Intergenic
1185272665 22:49935997-49936019 CCCTCCACCCCTGCTCCTCCCGG - Intergenic
1185418633 22:50722916-50722938 GCCTCCTGCCTTGCTTCCTCTGG + Intergenic
1203293464 22_KI270736v1_random:18128-18150 GTTTCCTTTCCTGCTCCTACTGG + Intergenic
950753850 3:15155777-15155799 GCCTCCCTCCCTCCTCCCACTGG - Intergenic
952003250 3:28810287-28810309 CCCTCCAGCCCTGCTCCTCTGGG - Intergenic
952407263 3:33015662-33015684 GCCTCCTGCCTGGCTCTCACAGG - Intronic
953179656 3:40583822-40583844 ACCTCCAGCCTTGCTGCTACAGG - Intergenic
953993094 3:47498928-47498950 ACCTCCTGACCTGCTCCTCCGGG - Intronic
954400117 3:50315066-50315088 GCCCACAGGCCTGCTCCTACTGG + Intergenic
955103833 3:55877192-55877214 GCCTCCTGGCCTCTACCTACTGG + Intronic
960281394 3:115784617-115784639 GCCGCCTTCCCTGCGCCGACGGG + Intergenic
961435509 3:126913731-126913753 GCCTCCTGCCGTGCTCCAGGTGG - Intronic
961675226 3:128560872-128560894 GCCGCCAGCCCTGCTGCCACTGG - Intergenic
961813684 3:129536536-129536558 GCCTCCTGCCCTCCTACTTCAGG - Intergenic
962025668 3:131544759-131544781 GCCACCTGCCCTGGTCTTCCAGG - Intronic
963140215 3:141940712-141940734 GCCTCCATTCCTTCTCCTACGGG - Intergenic
963761410 3:149289943-149289965 CCCTCCAGCCCTGCTCCTCTGGG + Intergenic
963917080 3:150868488-150868510 CCAACCTGGCCTGCTCCTACGGG + Intergenic
966730967 3:183151240-183151262 GCCTCCTCCTCAGCTCTTACTGG + Intronic
966927650 3:184655863-184655885 GGCTCCTTCCCTGGTCCTAGTGG - Intronic
967166343 3:186783281-186783303 CCCGCCCGCCCTGCTCCTACGGG - Intronic
967270183 3:187726616-187726638 GCCTCCTGCCTTGCCCCACCAGG + Intronic
968958882 4:3732743-3732765 GCCTCCTGCACTGATGCTCCCGG + Intergenic
969660166 4:8522802-8522824 AGCTCCTGCCCTGCTCCCTCCGG - Intergenic
973645487 4:52947062-52947084 GGCTCCTGCACTGTTCTTACAGG + Intronic
976148177 4:82064694-82064716 GCATCCTTCCCTACTCCAACTGG + Intergenic
978416098 4:108477655-108477677 GCCTTCTGCCCAGCTCTTCCTGG + Intergenic
979188944 4:117833723-117833745 CCCTCAAGCCCTGCTCCTCCGGG - Intergenic
981162639 4:141517041-141517063 GCCTTCTCCCTTGCTCCTGCTGG - Intergenic
982460976 4:155667865-155667887 GCCTCCAGCCCTGCTGCCTCCGG - Intronic
983156724 4:164356961-164356983 GCCTCCTACCCTCCACCCACTGG - Intronic
984233178 4:177124497-177124519 GGCTCCTGCTCTGCTTGTACTGG - Intergenic
985528678 5:421174-421196 GCCTCCTGCCCGGCACCAGCCGG - Intronic
985567309 5:625807-625829 CCCTCCAGCCCTGCTCTCACAGG + Intronic
985591685 5:768786-768808 GCCACCTTCCCTGCTCCGGCTGG + Intergenic
985609601 5:879745-879767 GCCACCTTCCCTGCTCCGGCTGG + Intronic
985793342 5:1944535-1944557 GCCTCCTGCTGTGCTGCTCCAGG - Intergenic
986704817 5:10446304-10446326 GCCTCCTGGCCTGCACCCACTGG + Intronic
986742127 5:10713419-10713441 CCCTCATTCCCTGCTCCTCCTGG - Intronic
986797117 5:11223171-11223193 CCCTTCTGCCATGCTCCTGCAGG + Intronic
987087380 5:14483461-14483483 GCCTCCTGCCCTACGCCATCAGG + Intronic
992392013 5:76338166-76338188 GGCTCCTGCCCTGCAGCCACTGG + Intronic
992896907 5:81253523-81253545 GCCTGCAGCCCTCCTCCTTCAGG + Intronic
995308362 5:110681324-110681346 TCCTGCTGCCCTGCTCCTCCCGG - Intronic
997240160 5:132301037-132301059 GCCTCCTGCCCTGAGGCTAAAGG + Intronic
997629591 5:135356678-135356700 GCCTCCTGCCCTGCCCTAAATGG - Intronic
998498172 5:142609107-142609129 GCCTCCTGCCCTGTTGCTTTAGG - Intronic
999267540 5:150276657-150276679 GCTTCCTGCCCTTCTCTTCCTGG - Intronic
999432522 5:151536512-151536534 GATTCCTGCCCTGCTGCTGCAGG - Intronic
1001413196 5:171525143-171525165 GCCACCTGCCCTGCCCCTCCAGG - Intergenic
1001700913 5:173705916-173705938 CCCTCCTGCCCTGCTCCCATGGG + Intergenic
1001780224 5:174361834-174361856 GCCTCCTGGCCTGCCCCTGTTGG - Intergenic
1001910825 5:175516125-175516147 GCCCACTGCCCTCCTCCTGCTGG + Intronic
1002104921 5:176875287-176875309 GCCTCCTGGCCAGCTCCATCTGG + Intronic
1002323432 5:178389277-178389299 GCCTCCTGGCCACCTCCTCCAGG + Intronic
1002529255 5:179834181-179834203 GGCTTCTGCCTGGCTCCTACAGG - Intronic
1002644708 5:180647525-180647547 GGCTTCTGGCCTGCTCCCACCGG + Intronic
1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG + Intergenic
1002880908 6:1251584-1251606 GCCTCCTGCCCTGTTTCTTTGGG + Intergenic
1002992942 6:2254817-2254839 CCCTCCTGCCCACCTCCTATAGG + Intergenic
1005910070 6:30301867-30301889 CCCTGCTGCCCTGCACCTCCCGG + Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1006420498 6:33930987-33931009 GCCTGCTGCCCTCCTCACACCGG - Intergenic
1007219744 6:40269090-40269112 GCCAACTGGCCTGCCCCTACAGG + Intergenic
1007393644 6:41564862-41564884 GCCACTTGCCCAGCACCTACTGG - Intronic
1007479476 6:42140939-42140961 TCCACTTGCCCTGCTCCTCCTGG + Intronic
1007630633 6:43271178-43271200 GCCTCCTCCCCTCCCCATACAGG - Intronic
1007967255 6:46014699-46014721 GCCTCCATCCTTCCTCCTACAGG + Intronic
1017070694 6:150573345-150573367 GGGCCCTGCCCTGCTCCTGCTGG - Intergenic
1019597344 7:1864254-1864276 GCCGCCTCCCCTCCTCCTTCAGG - Intronic
1020660415 7:10974385-10974407 CACCCCTGCCCTGCTCCCACCGG - Intronic
1021450599 7:20780172-20780194 TCCTTCCGCCCTGCTCCTACCGG - Intergenic
1022331600 7:29384496-29384518 GGCTCCTCCTCTGCTCCTCCTGG + Intronic
1022587947 7:31633620-31633642 GCCACCTGCCCAGCTCTTAAAGG + Intronic
1023156118 7:37254125-37254147 GCCTCCTGCCTTCCTTCTGCTGG - Intronic
1023344867 7:39261209-39261231 GCCACCTCTCCTGCTCCTGCAGG + Intronic
1024249050 7:47492521-47492543 ACCACCTGCCCACCTCCTACTGG + Intronic
1024787529 7:52925556-52925578 GCCTCCTGCCCTGCTCCTCTGGG - Intergenic
1025182840 7:56832336-56832358 AGCTCCTGCCCAGCTCCTACTGG - Intergenic
1025689086 7:63744638-63744660 AGCTCCTGCCCAGCTCCTACTGG + Intergenic
1025953516 7:66164844-66164866 GGCTCCTGCCCTGCTTTTTCTGG + Intergenic
1026045686 7:66904142-66904164 GGCTCCTGCCCAGCTCCCAGCGG + Intergenic
1026675577 7:72425411-72425433 GCCTCCTGCCCAGTTACTACCGG + Intronic
1026975560 7:74495633-74495655 CCCTCCTTCCCTCCTCCTCCAGG - Intronic
1027399286 7:77790731-77790753 GCCTCCTGAGCTGGTACTACAGG + Intergenic
1027421411 7:78020391-78020413 ACCTCCGGGCCTGCTCCTCCCGG - Intronic
1027429389 7:78094747-78094769 GACTCCTGCCCTTTTCCCACTGG + Intronic
1029127286 7:98303373-98303395 GCCTCCTCCCCTTCACCCACAGG + Intronic
1029899437 7:104023240-104023262 GCAGCCTGCCCTGCTCCAGCAGG + Intergenic
1030013044 7:105190075-105190097 TGCTCCTGGCCTGCTCCTGCTGG - Intronic
1030386874 7:108876252-108876274 CCCTTCAGCCCTGCTCCTCCAGG + Intergenic
1031639585 7:124145285-124145307 TTCTCCTGCCCTGCTCATACTGG + Intergenic
1032757569 7:134905651-134905673 CCCTCCAGCCCTGCTCCTCCAGG - Intronic
1033870802 7:145751595-145751617 CCCTCAAGCCCTGCTCCTCCAGG - Intergenic
1033941343 7:146658969-146658991 GCCACCTCCCCTGCAGCTACTGG + Intronic
1034489820 7:151387244-151387266 GCCTCCTGCCCTGGTCACCCAGG - Intronic
1035163460 7:156968324-156968346 GCCCCCCGCCCTGCCCCTCCGGG + Intronic
1035343056 7:158176881-158176903 GCCTCCACACCTGCTCCTCCAGG + Intronic
1035717488 8:1764620-1764642 GCGTCCCTCCCCGCTCCTACAGG - Intronic
1035792217 8:2317373-2317395 GCCTCACGCCCTGTTCCTCCGGG - Intergenic
1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG + Intergenic
1036191870 8:6678246-6678268 GCCTCCACCTCTTCTCCTACAGG - Intergenic
1037778243 8:21849598-21849620 GAGTCCTGCCCTGCCCCTCCCGG - Intergenic
1039659863 8:39449906-39449928 CCCTCCAGCCCTGCTCCTCCAGG + Intergenic
1039898738 8:41735402-41735424 CCCTCCTGTCCTCCTCCTCCTGG + Intronic
1040550288 8:48432195-48432217 TCATCCTGCCCTCCTCCTCCAGG - Intergenic
1041791468 8:61700337-61700359 CCCTCCTGCCCTGCTGCAAAGGG + Intronic
1043454845 8:80402862-80402884 GCCTACTGCCCTGCAGCCACAGG + Intergenic
1043645445 8:82511604-82511626 GCCTCCAACCCTGTTCCTCCTGG - Intergenic
1043789306 8:84443639-84443661 CCCTCATGCCTGGCTCCTACAGG - Intronic
1045108902 8:98920742-98920764 GCCTCTTGCCCTGCTTCTCCAGG - Intronic
1045459161 8:102412012-102412034 GCCTCCTGCTAGGCTCCTTCCGG - Intronic
1047893154 8:129335200-129335222 GCTTCCTGCCTTGCTCCAAAAGG - Intergenic
1048962227 8:139590098-139590120 GCCTTCTCCTCTGCTCCTTCAGG - Intergenic
1058382194 9:104389374-104389396 GCCTTCTCCCCATCTCCTACTGG - Intergenic
1061479047 9:130887519-130887541 GCGTCCTGCCCTGCCCCCTCGGG + Intronic
1061978857 9:134088257-134088279 CTCTTCTGCCCTGCTCCTCCTGG + Intergenic
1062162833 9:135089146-135089168 GCCGCCCTCCCTGCTCCTTCAGG + Intronic
1062418049 9:136463370-136463392 GGATCCCGCCCTGCTCCTTCGGG + Intronic
1185501497 X:600088-600110 GCCTCTTCCCCAGCTCCTGCTGG + Intergenic
1188569033 X:31560021-31560043 GCCACCTGCTTAGCTCCTACAGG + Intronic
1189414721 X:40803799-40803821 CCCTCCAGCCCTGTTCCTCCGGG - Intergenic
1189746292 X:44172026-44172048 GCCCCCTGCCCTGCTCCCAGAGG - Intronic
1191758657 X:64623469-64623491 GCATCCTGTCCTGCTACTCCAGG - Intergenic
1193883801 X:86960321-86960343 CCCACCAGCCCTGCTCCTTCTGG - Intergenic
1199810840 X:151347009-151347031 GCCCCCAGCCCTGCTACTCCAGG - Intergenic
1199979065 X:152911149-152911171 GAGGCCAGCCCTGCTCCTACTGG - Intergenic
1200476997 Y:3650062-3650084 CCCTCCAACCCTGCTCCTCCTGG - Intergenic