ID: 1085513813

View in Genome Browser
Species Human (GRCh38)
Location 11:77100925-77100947
Sequence CCCGGAACTGCTCTCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085513799_1085513813 26 Left 1085513799 11:77100876-77100898 CCTTCACCTTCAGCCGCCTCAGT 0: 1
1: 0
2: 2
3: 46
4: 734
Right 1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
1085513800_1085513813 20 Left 1085513800 11:77100882-77100904 CCTTCAGCCGCCTCAGTCACCTG 0: 1
1: 0
2: 0
3: 20
4: 268
Right 1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
1085513801_1085513813 13 Left 1085513801 11:77100889-77100911 CCGCCTCAGTCACCTGCTGCCAT 0: 1
1: 1
2: 4
3: 44
4: 392
Right 1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
1085513807_1085513813 -6 Left 1085513807 11:77100908-77100930 CCATGCCACAGCCCGGGCCCGGA 0: 1
1: 0
2: 1
3: 20
4: 278
Right 1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
1085513802_1085513813 10 Left 1085513802 11:77100892-77100914 CCTCAGTCACCTGCTGCCATGCC 0: 1
1: 0
2: 17
3: 230
4: 1767
Right 1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
1085513803_1085513813 1 Left 1085513803 11:77100901-77100923 CCTGCTGCCATGCCACAGCCCGG 0: 1
1: 0
2: 3
3: 18
4: 261
Right 1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085513813 Original CRISPR CCCGGAACTGCTCTCCCTGG AGG Intronic
900472223 1:2860610-2860632 CCCGGAATTCCTCTTCCTGGCGG + Intergenic
900734370 1:4286603-4286625 CCCCAAACTGCTTTCCATGGTGG + Intergenic
902366105 1:15975605-15975627 CCCGGCACTGCGCTCCCTCGCGG + Intronic
902917690 1:19648501-19648523 CCCGGAGCTGGCCTTCCTGGGGG + Intronic
903675494 1:25062119-25062141 TCCAGAACGGCTCTCCCAGGAGG + Intergenic
903754359 1:25650531-25650553 CCTGGACCTGCTCTCTCTGCGGG - Intronic
903830563 1:26171666-26171688 GGCGGCACTGGTCTCCCTGGCGG + Exonic
908959959 1:69684905-69684927 CCCTGCTCTGCTCTCCCTGGTGG + Intronic
914713464 1:150235396-150235418 CCCGGCACTCCTCCTCCTGGGGG - Intronic
915462175 1:156076786-156076808 CCTGGAGCGGCTCTCCCGGGGGG + Exonic
916386708 1:164281352-164281374 CCCCTAACTTCTCTCCCTGTTGG - Intergenic
918230605 1:182527857-182527879 CTCTGTACTGCTCTCTCTGGGGG - Intronic
922156002 1:223040091-223040113 CCCGAAACTGCTCTGCATGGAGG + Intergenic
924624853 1:245689172-245689194 CCCGCACCTGCTCGCTCTGGGGG + Intronic
1063223083 10:3989288-3989310 CCCAGAGCTGCTTTGCCTGGAGG + Intergenic
1063462170 10:6221816-6221838 CACGGAAGTGAACTCCCTGGAGG - Intronic
1064266103 10:13826763-13826785 ACCGATACTGCTCTCCCGGGAGG + Intronic
1064702907 10:18040304-18040326 TCCAGAACTGCTCTCCTGGGTGG - Intronic
1067796522 10:49325727-49325749 GCAGGCACTGCTCTCCCCGGGGG - Exonic
1069913138 10:71771946-71771968 CCCTGCACTGCCCTCCCTGGTGG - Intronic
1070547166 10:77461653-77461675 CCCGTAAGTGTTCTGCCTGGAGG - Intronic
1070588069 10:77781076-77781098 CCTGGACCTGCTCACCCAGGCGG - Intergenic
1072241189 10:93496766-93496788 CACTGACCTGCCCTCCCTGGCGG - Exonic
1074629607 10:115237256-115237278 CCAGGAATTGCACTCCATGGTGG - Intronic
1076140854 10:128077625-128077647 CTCGGACCTGCTCCTCCTGGCGG - Exonic
1076538513 10:131198626-131198648 CCCACAGCTGCTCTCCCAGGTGG + Intronic
1076569078 10:131420486-131420508 CCCAGCGCTGCTCTCTCTGGGGG + Intergenic
1077258256 11:1599294-1599316 CTCCAAACTGCTCTCCGTGGTGG - Intergenic
1077296050 11:1826765-1826787 CCTGGCAGTGCGCTCCCTGGAGG - Intergenic
1077411515 11:2405986-2406008 CCCAGAGCTCCTCTCCCTGATGG - Intronic
1080802171 11:35618876-35618898 CCGGGCGCTGCTCACCCTGGCGG + Exonic
1081657412 11:44866619-44866641 CCCGGAACAGCTCTTCCAAGAGG - Intronic
1084149890 11:67283154-67283176 CCCTGAACTACGCTCCCTGCTGG + Exonic
1084803296 11:71560940-71560962 CTCCAAACTGCTCTCCATGGTGG + Intronic
1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG + Intronic
1088592294 11:111414318-111414340 ACCTGGACCGCTCTCCCTGGTGG - Intronic
1089772644 11:120814729-120814751 ACGGGACCTGCTCTACCTGGGGG + Intronic
1092270233 12:7018162-7018184 CCCGGCACAGCCCTCCCGGGTGG + Intronic
1092275899 12:7060781-7060803 CCCTGTGCTGCTGTCCCTGGGGG + Intronic
1092665871 12:10796869-10796891 CCTGAAATTACTCTCCCTGGAGG - Intergenic
1096174508 12:49503788-49503810 CCCGGAACTGCGTTTCCTGCTGG - Intronic
1098313638 12:69171667-69171689 CCCAGAAGCACTCTCCCTGGAGG + Intergenic
1099714754 12:86277003-86277025 CTCCGAACTGTTCTCCCTAGTGG + Intronic
1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG + Intronic
1103092014 12:118104111-118104133 CTCGGTACTGCTGTCCCGGGCGG - Intronic
1104443129 12:128811485-128811507 CCCTGCATTGCTCTACCTGGGGG + Intronic
1105460926 13:20585696-20585718 CCCTGAAATGCTCTGCCTGACGG - Intronic
1105532334 13:21231126-21231148 CCCTGACCTGCTCCACCTGGGGG + Intergenic
1113716786 13:112515360-112515382 CCAGGAACCGATCTACCTGGTGG + Intronic
1118762654 14:68890172-68890194 GCCGGAACTTCTCTGCCAGGTGG + Exonic
1119205603 14:72791447-72791469 CAGGGCACTGCTCTCCCTGGTGG - Intronic
1120953077 14:90060605-90060627 CCCAGATCTGCGCGCCCTGGTGG + Intergenic
1121521263 14:94587587-94587609 CCTGGCCATGCTCTCCCTGGGGG + Exonic
1121813832 14:96914120-96914142 CCTGGAACAGCTGTCCCTGGTGG + Intronic
1122379372 14:101290733-101290755 CCCGGAGCTGCTCTCTCTCCAGG + Intergenic
1123539178 15:21270657-21270679 CCAGGACCTGCTCTGCCTGTGGG + Intergenic
1124370888 15:29104024-29104046 CGTGGAACTGCCCTCCCTGACGG - Intronic
1125609996 15:40963505-40963527 CCCGGAACTGTGCTCCATGCTGG - Intergenic
1125739333 15:41951113-41951135 CCCAGCACTGATCTCACTGGTGG + Intronic
1127973452 15:63979946-63979968 CCAGGAACTCCTCTCCTGGGAGG + Intronic
1129192241 15:73944321-73944343 CCCGGACCTGCGCTCCCAGCTGG + Intronic
1132590558 16:724574-724596 CCCGGCACTGCTCAGCCTGCTGG - Intronic
1137614789 16:49839673-49839695 CCCGGCTCTGTTCTCTCTGGAGG - Intronic
1139969989 16:70768352-70768374 CTCGTGACTGCTCTGCCTGGTGG - Intronic
1142637677 17:1268244-1268266 CCCGGACTTTCTCTCCCGGGCGG + Intergenic
1144316787 17:14069498-14069520 CCCGGAACTACTCCCACAGGGGG + Intronic
1144967760 17:19088909-19088931 GCCAGCACTGCTCTCCCTGAGGG + Intergenic
1144980156 17:19163154-19163176 GCCAGCACTGCTCTCCCTGAGGG - Intergenic
1144988066 17:19215078-19215100 GCCAGCACTGCTCTCCCTGAGGG + Intergenic
1145747871 17:27333246-27333268 CCCAGAGCTCCGCTCCCTGGAGG + Intergenic
1145940447 17:28740837-28740859 CCTGGACCACCTCTCCCTGGGGG + Exonic
1147965130 17:44190628-44190650 CCTGGAACAGCTGACCCTGGGGG - Exonic
1153622306 18:6990489-6990511 CCAGGACCTGCCCACCCTGGAGG - Intronic
1160330848 18:77990454-77990476 TCCGGAAATGCTTTCCCTCGAGG - Intergenic
1160344822 18:78124065-78124087 CCCGCACCTGCCCTTCCTGGAGG - Intergenic
1160878610 19:1309474-1309496 ACCTGTGCTGCTCTCCCTGGAGG - Intergenic
1162789454 19:13055408-13055430 CTCAGCACTGCCCTCCCTGGCGG - Intronic
1165828283 19:38718019-38718041 GCCGGAACTTCTCTGCCAGGTGG - Exonic
1166044993 19:40224745-40224767 CCCGGAGATGCGCGCCCTGGTGG - Exonic
1166863706 19:45823830-45823852 CCCGGAGCTGCTCCTGCTGGTGG - Exonic
1167160955 19:47766708-47766730 CCCTGAAATTCTGTCCCTGGAGG - Intergenic
924977130 2:188138-188160 CCCAGGACTGCTCTCTCTGAGGG - Intergenic
925132422 2:1503247-1503269 CCAGGAGCTGCTCTGTCTGGAGG - Intronic
925838959 2:7972868-7972890 CCCGCACCTGCCCTGCCTGGGGG + Intergenic
927990196 2:27442282-27442304 CCCGGGCCCGCTCCCCCTGGCGG - Intergenic
928307109 2:30179248-30179270 CCCAGAAATGCTCTCCCACGTGG - Intergenic
929403488 2:41612729-41612751 CAGGGAACTGCTCTGCCTGCAGG - Intergenic
933317589 2:80734350-80734372 CTCCGAACTGTTCTCCCTAGTGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
939263666 2:139843286-139843308 CCCCGAACTGTTCTCCATAGTGG - Intergenic
939944752 2:148396149-148396171 CCTGGAACTGCTCTCGCTAAGGG + Intronic
941396407 2:164979261-164979283 CCAGGACCTGCTCTGCCTGTGGG + Intergenic
943279965 2:185919269-185919291 CTCCAAACTGCTCTCCATGGTGG + Intergenic
946010870 2:216562537-216562559 CTCAGACCTGTTCTCCCTGGGGG - Intronic
947538783 2:230959962-230959984 CTCAGAAAAGCTCTCCCTGGGGG + Intronic
947632685 2:231664124-231664146 CACGGAAAACCTCTCCCTGGAGG + Intergenic
947718377 2:232352890-232352912 CCAGGATCAGCTCTCCCCGGGGG + Intergenic
1172916528 20:38447567-38447589 CCCTGATCTGCACTCCCTGAGGG + Intergenic
1175251655 20:57613615-57613637 CCCCACACTGCTCTCCCTAGGGG + Intronic
1179902700 21:44402201-44402223 CCTTGCACTGCTCTTCCTGGGGG - Intronic
1179983908 21:44910746-44910768 CCCCCCACTGCTCGCCCTGGTGG - Exonic
1180149032 21:45938338-45938360 CCAGGAGCTGCTCTCCCTCCTGG + Intronic
1180911729 22:19455534-19455556 CCCTTAGCTGCTCTCCTTGGTGG - Intronic
1180917054 22:19496715-19496737 CTTGGAAATTCTCTCCCTGGAGG + Intronic
1181128374 22:20714936-20714958 CTGGGAAATGCTCTTCCTGGAGG + Intronic
1181370075 22:22408925-22408947 CCCAGGAATGCTCTTCCTGGTGG - Intergenic
1183716022 22:39534198-39534220 CACAGCACTGCTCTCCCTGGTGG - Intergenic
950359865 3:12442561-12442583 CAAGGAACTTCTCTCCCTGAAGG - Intergenic
950727033 3:14923263-14923285 CCTGAAACCGCTTTCCCTGGAGG + Intronic
950831333 3:15878812-15878834 CCTGGACCTGCTCTTCCAGGCGG + Intergenic
958621164 3:96563046-96563068 CCCGGAAATCCTCTCTCAGGAGG + Intergenic
961394695 3:126578686-126578708 CCAGGAACTGCTCTCCTGGTGGG + Intronic
964692401 3:159465045-159465067 CCCTGAACTGAGCTCTCTGGGGG - Intronic
966940131 3:184740986-184741008 CCTGGGACAGCTCTCCCAGGTGG - Intergenic
968433645 4:574549-574571 CCTGGGGCTGCTCTGCCTGGTGG - Intergenic
968512868 4:1003118-1003140 GCCGGAACTGCTCTGCCGTGGGG - Exonic
968831371 4:2934359-2934381 CCCGGACTCGGTCTCCCTGGCGG + Exonic
968951875 4:3699701-3699723 CACTGAGCTTCTCTCCCTGGAGG + Intergenic
969230210 4:5825340-5825362 CCCGAGCCTGCTCTCACTGGTGG - Intronic
969324118 4:6431167-6431189 CACGGACCTGCACACCCTGGTGG - Intronic
972514896 4:39802380-39802402 GCCTGAAATGCTCTTCCTGGAGG + Intergenic
985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG + Exonic
992741142 5:79774662-79774684 CCTGGAAATGCTTGCCCTGGAGG - Intronic
994205597 5:97032081-97032103 CCAGGAAATGCTGTCCTTGGAGG - Exonic
994530558 5:100964862-100964884 CCCTGTCCTGCTTTCCCTGGAGG + Intergenic
996402879 5:123082628-123082650 CCAGGACCTCATCTCCCTGGGGG - Intergenic
998424223 5:142013121-142013143 CCCGGACCGACTCTCCCAGGTGG + Intergenic
999419954 5:151432156-151432178 CCAGGTACTGCAGTCCCTGGAGG + Intergenic
1000029261 5:157387992-157388014 CCCGGAAGCTCACTCCCTGGAGG - Intronic
1002663495 5:180806525-180806547 CACAGAGCTTCTCTCCCTGGAGG + Intronic
1004732073 6:18367786-18367808 CCTGGACCTGCTCACCCAGGCGG - Intergenic
1005501238 6:26430828-26430850 GCCCGGAATGCTCTCCCTGGAGG - Intergenic
1006378348 6:33684100-33684122 GCCTGAGCTGCTCTTCCTGGAGG + Exonic
1007606132 6:43119456-43119478 CCTGGCACTGTTCTCCATGGTGG + Intronic
1009324822 6:62337638-62337660 CCCTGAGCTGCTCTCCATGTTGG - Intergenic
1017805870 6:157945167-157945189 CCCGGGACTGCTGCTCCTGGTGG - Intergenic
1017810571 6:157981248-157981270 CCCCCAACACCTCTCCCTGGCGG + Intergenic
1018905170 6:168071800-168071822 CCTGGAACAGCTCCCACTGGCGG - Intronic
1019088233 6:169501788-169501810 CCCGCGACTGCCCTGCCTGGTGG + Intronic
1019850891 7:3555987-3556009 CTCCAAACTGCTCTCCATGGTGG - Intronic
1023835938 7:44067166-44067188 ACCTGAATTGCTCTCCCTGTAGG - Intronic
1027613496 7:80391989-80392011 CCCTGAACTGCTCTAGATGGTGG - Intronic
1033097081 7:138441477-138441499 CCTGGACCTGCTCACCCAGGTGG + Intergenic
1033287402 7:140054335-140054357 CAGGGAACTGCTCAGCCTGGTGG - Intronic
1035034690 7:155887113-155887135 CTGGGAACTGCAGTCCCTGGAGG - Intergenic
1035242213 7:157539693-157539715 CCCTGATCTCCTCTCCCGGGAGG + Exonic
1036517476 8:9458182-9458204 CCCTGAGCTTCTCTTCCTGGTGG + Intergenic
1038292276 8:26260538-26260560 CAAGGACATGCTCTCCCTGGAGG - Intergenic
1038456685 8:27676342-27676364 TCCTGCACTGCTCTCACTGGTGG - Intronic
1038976929 8:32708876-32708898 CCCGGGACAGCTTTCACTGGTGG + Intronic
1047275345 8:123401349-123401371 CCTGGACCTGCTCACCCAGGCGG + Intronic
1049725447 8:144143557-144143579 CCCAGAACTGATCTTCTTGGAGG + Intergenic
1052941352 9:34133900-34133922 CCTGGACCTGCTCACCCAGGTGG - Intergenic
1054459708 9:65456076-65456098 CCACCCACTGCTCTCCCTGGAGG - Intergenic
1057705614 9:97392948-97392970 CCCAGAACAGGGCTCCCTGGGGG - Intergenic
1058893976 9:109383974-109383996 CCCTTAACTGCTGTGCCTGGAGG - Intronic
1060751602 9:126173424-126173446 CCTGGATCTGCTATCCTTGGAGG + Intergenic
1060828790 9:126701132-126701154 TCCGGACCTGCTGTCCCTGGTGG - Intergenic
1060987695 9:127829033-127829055 CCCTGACCTCCTCTCTCTGGTGG + Intronic
1062207888 9:135347242-135347264 CCCAGAACTCCTCCCCCAGGGGG + Intergenic
1062414597 9:136441861-136441883 CCGAGCACTGCTCACCCTGGGGG - Intronic
1062712874 9:137986231-137986253 CCCTGGACTTCTCTCCCTGAGGG - Intronic
1186369047 X:8927835-8927857 CCCCGCAGCGCTCTCCCTGGTGG + Intergenic
1191813405 X:65216667-65216689 CCCTGCACTGCACTGCCTGGTGG - Intergenic
1192530629 X:71880654-71880676 CTCCAAACTGCTCTCCATGGTGG - Intergenic